Skip to main content

Advertisement

Table 2 Information for nine markers that were sequenced from a set of 68 L. sativa accessions.

From: Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1

Marker EST/Contig in CGPDB Primers (5' - 3') Ta (°C) Mg (mM) Amplicon size (bp)
LK1457 QG_CA_Contig4638 F - AGGAGCAAAGGAAAGGCTTC 57 1.5 636-648
   R - TGCAACTTCTTCAGCCAATG    
Cntg10044 CLS_S3_Contig10044 F - GCATGCCGATTACTCCTTTC R - TCCCCAATCACCTAAGATGG 57 1.5 845-860
QGG19E03 QGG19E03.yg.ab1 F - ATATCCCACCGCCCATAGAT 57 1.5 711-720
   R - ACGCAACTAACCCGTTTCAT    
Cntg4252 CLS_S3_Contig4252 F - GGGGAGTTCAGACGTTCAGT 57 1.5 1160
   R - CGAATTGATACACCGCAAAA    
Cntg10192 CLS_S3_Contig10192 F - CTCGTTTTCAACACCGACAA 57 1.5 349
   R - TTGTCTCCGGCACTGTATCATCG    
CLSM9959 CLSM9959.b1_N18.ab1 F - TGCTCAATTACACTCGAACCA 57 1.5 326
   R - CTTCATGGAGAGAAATACAAGGTC    
CLSZ1525 CLSZ1525.b1_J22.ab1 F - TTGTTGAAATTATAAACACGAAGCA 57 3 499-629
   R - CAACAAAGGATGTCTCAAATTCA    
QGC11N03 QGC11N03.yg.ab1 F - GCACCTGATGGCTGAATATG 57 1.5 569-581
   R - CATCCTCAATCGCTTGTGTT    
Cntg11275 CLS_S3_Contig11275 F - GGAGAAATTTTGGAGCTGTAATTAC 61 1.5 765-956
   R - GGAGGTATGTTGAGGTACATGAC    
  1. Columns indicate marker name, EST or Contig information in the CGPDB database, forward and reverse primers, annealing temperature (Ta), magnesium concentration in PCR reaction, and size of amplicon. Marker QGG19E03 could not be successfully amplified from 13 accessions even though 34 primer combinations were tested.