Skip to main content

Table 4 Gene and EST-based marker primer sequences. Primers used for DNA amplification in the markers obtained from Fragaria gene or EST or Prunus EST sequences.

From: Synteny conservation between two distantly-related Rosaceae genomes: Prunus (the stone fruits) and Fragaria(the strawberry)

Origin Locus name Forward primer sequence 5' – 3' Reverse primer sequence 5' – 3' Referencea
Fragaria gene EKO ACAGTCCAGCTCCAATAGTTCC GCTTTCCCATTGATTCTTGTCC AY462247
  F3H GAGTTGATACCAAGCTCATCTCG GTCACCTCTCTCCATCCTTCC AB097151
  DFR CCACTCCTATGGATTTTGAGTCC CTAGCACCCCATTTATTGTTGG AB095030
  ADH GCKTCAMGAATTATYGGKGTTG ATGGGASTTKRTGGGTGATG X15588
Fragaria EST EFvVB2179 ATCTGCGTGACAATGCAAAG AAGAGCCTTCAGTTGCTCCA CX662179
  EFvVB2119 GCTCGAGCTGATTACGATTACC TAAAGGACCCATCAGAGAAACG CX662119
  EFvNH8894 GGTTAGGTCTCCCCAGTGGT GGACGTCTCCCACTAGCATC DV438894
  EFvVB1231 CCAACTGTGACATCCACGAC GCTGTCACGCAGAAAATCAA CX661231
  EFaUF6868 GCTCTTCCAGGTCGAGTACG GTTTCCACTTGGGCAGTTGT CO816868
  EFaTR1976 GTTGGTGCTGAGTTTGGTGA CCCAACTGCTCAAGAAGGAG CO381976
  EFaUF7699 GTTCTTGTTGGTGGAAGCAC CCTCAAAGACCTGAATGGAG CO817699
  EFaUF7084 CAGAAGAGGTTCAAGTTCC ACACCATAGCAAGCCCTG CO817084
  EFvNH8484 TTCTGGTGTCGGCAAGTC AGGCCTGCTCAACATTGG DV438484
  EFvVB2013 GTGCAGTTGCCAAAGGAGC AGCTGGGTTTGCTGCTT CX662013
  EFvNH9852 TTCTGTCGTGGTGTCCC ATGATCTTTTGGCGACCA DV439852
  EFvNH7822 GATGCTGGGTCTGCTGGG GCCTGCTCATTGGCATA CO817822
  EFaUF7248 ACTGCTCGCCCAATGAAG TCACATCAGCATCCATGTCA CO817248
  EFavB1923 GGCCGTGTCTCTTGCAGT TGGGAGCAAATCCACCTT CX661923
  ACO AGCACCTTCTACCTCAAACACC CTCACAGAACAAGTCCAAGAGC AF129073
Prunus EST EPpCU9642 TTCAGTTGGCAGATCCTGTG TGCTGAGACCCTTCCAATTT BU039642
  EPpCU1785 TTTTCCAAACCTTGCTGGAG GCAGTAGCTGTGGCAATGAA BU041785
  EPpCU7308 GGCAGGCCGCTCTTATACTA GACTCTTTTCGGGGTTCCA BU047308
  EPpCU9257 CACCACCGTTTCAAAAGAGG CTGAAGCTCTAGCTGAGGCAAG BU039257
  EPpCU1830 TGATGCAATTGGCACAAAGC CCTATCACCACTTACTTCACTGC BU041830
  EPpCU9910 ATAACTCTGCCATCCGAATCC CATTCCTTGAACAGATCCTTGC BU039910
  EPpCU9223 AACAGAGCCAAGCTTATGCAG TTTCTGCGCAACCGCATC BU039223
  EPpCU2875 AACTCAGAGACATATCTGCACAGG AAGTTGAAGCGGTCTTCATAGG BU042875
  1. aEMBL accession numbers for the sequences from which novel primer pairs were designed