Skip to main content

Advertisement

Table 3 Newly identified candidate miRNAs in rice.

From: Identification of novel and candidate miRNAs in rice by high throughput sequencing

Putative miRNA_id Putative miRNA sequence Length Location Number of hits to rice genome Frequency in the untreated library Frequency in the drought-stressed library Frequency in the salt-stressed library
spmiR56 UCUCUUAUAUUUUGAGUGGUCA 22 intergenic 1 0 0 1
spmiR58 UGGAUGGACCUGGAGCAUCGAC 21 intergenic 1 0 0 2
cpmiR37 CGCUAAUGUUGCAGCAAACUG 20 intergenic 2 2 0 0
dpmiR41 UACCCGGUUUUGCAGUCAAGGG 22 intergenic 4 0 11 0
spmiR63 UUUGGACGGAGGGAGUAUCUC 21 intergenic 4 0 0 7
cpmiR99 CGAGUCAUGCAACCAAUCACUG 22 intergenic 5 3 0 2
cpmiR130 ACGCUAUUGUUGCAGCAAACUG 21 intergenic 6 2 0 2
cpmiR34 UUUGAGACGGAGGGAGUAACU 21 intergenic 7 31 0 0
cpmiR164 UUCGAUAGGUACCUUGUCGA 20 intergenic 7 1 5 0
cpmiR96 GGAUGUCGGAAGAGGUUUUUA 20 intergenic 8 11 0 0
cpmiR5 AGAAUGUGUCACAUCCGGUACU 22 intergenic 9 15 0 24
cpmiR123 CCACGUGUAAAGAAGACCCGGU 22 intergenic 9 3 4 2
cpmiR179 UAUUAGGAUGUGUUACAUCC 20 intergenic 9 17 0 0
spmiR37 UACAUUUUAGGACGGAGGAA 20 intergenic 9 0 2 9
cpmiR19 GAUCCUUGAGGGCUAAUUCA 20 intergenic 10 4 2 0
dpmiR50 ACGAUCAAACGUUGGGCACG 20 intergenic 11 0 12 0
cpmiR148 GCCAAAUCAGAUGGAGAGUU 20 intergenic 13 6 2 0
cpmiR79 UCUAGUACUAUGAAUCUGGAU 21 intergenic 15 5 0 4
cpmiR155 GCGCACGGAGGUGAGGAACC 20 intergenic 15 14 7 0
cpmiR185 CCAACUUUGAUCGUCCGUUUU 21 intergenic 15 12 0 7
spmiR44 UUUGUCGGAUGAAGAAAUGACU 22 intergenic 15 0 0 12
cpmiR175 AUGAGACGGAGGGAGUAUAU 20 intergenic 20 19 0 0
dpmiR4 ACUGUUUGACCACUCGUUUUA 21 intergenic 20 0 10 0
dpmiR10 UGUGGCAUGCCACACGGACAU 21 intergenic 20 0 10 0
dpmiR56 CGUUGUAUCUGGUUUUGCGGUU 22 intergenic 20 0 11 0
cpmiR47 UUCGUCCCUUGACCGCAAAAC 21 intergenic 22 3 3 0
dpmiR15 AUUUUGAGUUUUUGUUUGUAUU 22 intergenic 23 0 4 0
cpmiR3 UUAUGAGACGGAGGGAGUAC 20 intergenic 27 17 0 0
cpmiR7 AGACGAGUGGUCAAACAGUGU 21 intergenic 35 87 5 0
spmiR27 UGGCUAUAUUUAGUUUGCUG 20 intergenic 37 0 0 12
dpmiR26 UUUUUAUAGGACGGAGGGAGU 21 intergenic 39 0 11 0
cpmiR116 UUGCACUGUUUGACCAUUCGUC 22 intergenic 52 24 0 0
cpmiR105 CGAUUUUCGUCCUUCAACCG 20 intergenic 58 11 0 0
spmiR31 GGUGGCAGGAGGACGGCGCCA 21 intergenic 68 0 2 3
cpmiR74 UGACCCUAAACCACAAAACC 20 intergenic 72 10 0 0
cpmiR110 UAAGACGGACGAUCAAAGUUG 21 intergenic 76 13 0 6
cpmiR85 ACGAAUUACCCCCCUCGACC 20 intergenic 121 8 2 2
cpmiR32 UGCCCGUGCGUUGCAACGGGU 21 intergenic 129 13 0 9
cpmiR182 UGACUAUCAAAAGUAGAUGGAGG 23 intergenic 212 9 1 18
cpmiR188 ACUAUCAAAAGUAGAUGGAG 20 intergenic 306 11 1 0