Skip to main content

Table 8 Control oligos

From: Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

Control name Apple EST Genbank Acc. TAIR acc.  
MdAC1 1412 EB106245   CGAACCAACACCAAAGGCCCTCAAGGCGGGCAGCATCACTACCAT
MdAC2 1412 EB106245   GCTCTTCCACATGCCATCTTGAGGCTTGACCTTGCAGGTCGTGAT
MdAC3 1412 EB106245   TACTTAAAATGTCTGGATTCTATGAGTTTGTAGGTTTGCCGCTGG
MdAC4 14223 EB109811   CTTCAATCTGAAAAATCTTCCTTCAAATTCTCTTTCCAAGCTTCTTCAGCC
MdAC5 14223 EB109811   TGAGGTGGAGAGCTCCGACACCATAGACAACGTGAAGGCCAAGATTCAAG
MdAC6 14223 EB109811   AATGGTACTGTTTTTGCCTCCTAAGATGAGGCATCTGGGCAAGTTTGTG
MdAC7 704 CN934151   CAACATCGTGGTCATTGGCCATGTCGACTCCGGCAAGTCGACCAC
MdAC8 704 CN934151   TGTTGAGACTGGTATCGTCAAGCCTGGTATGGTTGTGACTTTTGG
MdAC9 704 CN934151   GGTGGTGACCCATCAAGTTTATGTTGTGTCGATTCCGCCTTCTGA
MdAC10 59854 CN862467   GTGTTATGTATGCATAAGGAAGGTTATGGTTTATGCTGCTCCCTG
MdAC11 8626 CN923132   GCCATAAGCTTTAAGCTCTTCTCTCTGATTTCTCACAATTCAACTCGC
MdAC12 29626 EB111272   ACGAGCCTTGCACCAACCTTAATTTGAAAAGAAGTAATGCAAGTG
MdAC13 29626 EB111272   AAGACGATAAACAACTGGTTCATCAATCAGCGGAAGAGGAACTGG
MdAC14 58802 EB175510   CCTGGGTGGATGCTTTGACTTTGTTTGTGCCTAATAATAATACCC
MdAC15 64768 EB116541   GACTCTGGAACCATTATATGAATGCCATCTCGGATGCTTTGCTGC
MdAC16 15992 EB114519   ACGAATCGAGAACACGATAAGCAGGCAAGTGACATTCTCAAAGAG
BtAC17   U89872   TTCCAATTCACTTCCCATCGACATCTACCAGATATCGAGTTCGTG
ShAC18   X17220   CACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCG
AvAC19   AF078810   GCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTG
HsAC20   NM_000518   GTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTC
EcAC21   A00196   TAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGC
EcAC22   K01193   GTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAAC
PpAC23   X65316   AGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGTCCAAATTG
EcAC24   V00618   TCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA
HsAC25   AF126021   CAGTGTTGTTCCCTCCCTCAAGGCTGGGAGGAGATAAACACCAAC
HsAC26   X13988   AAGAGTGAGCCAGCCCTTCTGGAGCAGGAGCAGGACAGAAGATAT
HsAC27   M21812   CACGCAGTGTGACCGCTTCTCCCAGGAGGAGATCAAGAACATGTG
HsAC28   X07868   TCAGCTCCTTTAACGCTAATATTTCCGGCAAAATCCCATGCTTGG
HsAC29   AK001779   GTGCCGGACTTACCTTTCATTGAACATGCTGCCATAACTTAGATT
HsAC30   AF161469   ATGCTTAAGATTCAACTGGGAGCATACCAGGGATGCTCTCTAACG
HsAC31   NM_004048   TGGCAACTTAGAGGTGGGGAGCAGAGAATTCTCTTATCCAACATC
HsAC32   NM_000291   GCTCATCTTCACTGCACCCTGGATTTGCATACATTCTTCAAGATC
HsAC33   L11329   GTGTCATGTTGCGTGTGTCTGTCTGTGAGCCTTTCACACCTGTGC
HsAC34   U11861   GAGTTGGAGCACGGTCTCTATGGGGAAGCGTTCGCTGTCTATCAG
Aunc1    At1g14400 GCTAACTCCTGATGGAGAGCTTTCGAAAATCAGTTGAATCAACCTCTGTT
Aunc2    At1g16210 GTCGATTTCATCATCATGTCCACCGATGTGCATTTGCAATTTGAAACGCAT
Aunc3    At1g43900 CCGGCTCAGAGTAAGGACTTGGATTCCTACCTTATTGGTAGGGTGGCGGTGC
Aunc4    At3g13060 GCCTGCCCGTGACGAGAGCGGTGCTACTATTAGGCATTTTACGAGTTAGCC
Aunc5    At3g19420 ATGCCTCCGTTTTCTCGTTTGGAGATGACGAGGACTCTGAAAGTGAGTAAACAAGG
Aunc6    At3g19760 CACAGAATTGGTCGTAGTGGACGTTTTGGAAGGAAGGGTGTTGCCATCAACTTCG
Aunc7    At4g00660 GCCGGTGATTGGTGGTGGAGAACCTTGATGTGACAGCAATGATGGGATGA