Skip to main content

Table 1 Oligonucleotides used for qRT-PCR validations

From: Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis

GenBank (dbEST) Accession Number EST/Gene name Forward primer 5'-3' Reverse primer 3'-5'
BU671885 EF127 GCATTGGGCAGATCTTGTTT GTCCCCTTTGGAGGCAGTA
BU671886 EF264 GGAGCTTGAGGATGCGATAC GAAACGTAAAGCCCCGATAA
BU671910 EF502 TGATCCATCAATCTCCGTCTT TGTAGGTGCATGGAACAAGC
BU671987 F171 AAAGGATCAGTCGCTGCTGT GCTTTTCCAAGATTGCATCC
BU671927 F126 CAAAATGCAACGACCCATTA TCTGTACGCCCTCATGTTCA
BU671928 F231 CAACAAAAGCAGACGCTGAA AGCATGTGGTGTTTGGACAG
BU671983 F379 CAGCCCGGAGAGGTTTAACT GGCAGGTACAGAATCGGCTA
BU671999 F443 AATCCCATCAATCCCCACTT GTTTCCACCCCTTCCATTTT
BU672004 F455 GCCGAGGTACAAACTGGAGA TGAGCATGATCTGAATATCTTGAA
BU672026 F543 ACGGAAGCGTTGTTTGGTAA TCAACATCCCACAGAAACGA
BU672017 F550 CAGAGACGTTCTTGCGTTGA CGCACACAACAAAGAAATGG
BU672042 F557 CGCAATTGCTATTGATGGAA ACACCGGTATGGTTGATGCT
BU672056 H110 ACGCGAGTCGGTTGTTTTAT TCATTTTCTCCACCCATGGTA
BU672069 H123 GGCAGGTACCAGGGGTTATT GAGGTTCATTCCGTCGTTGT
BU672102 H136 TTTGCAAGGATGAATGGTGA GTGACCCGAACTCCTTGGTA
BU672086 H360 GGCAGCCAATCCTCTTGATA CGACTCCGCCAAATACAGAT
BU672090 H385 TTCAGCCCGGAAAGAATATG AACTTTGCAGTGGGACCATC
BU671806 T124 GGAACACCGTGAAGGATGAG GGCAGGTACATCTTGGCCAAT
BU671875 T283 CTCACGAAAGCTTCCTGCTT GCAGGTACTCGGTTTGTTCC
BU671843 T340 AAGACGGTGGATTTGAGGTG AACCTTTGCCTGCTTTCTCA
BU671801 T411 GGCAAGGGAAAACACCACTA TGTTGAGGTGTGGCTCTGTC
AAF82805 sunflower actin AGGGCGGTCTTTCCAAGTAT ACATACATGGCGGGAACATT