Skip to main content

Table 4 Primers used in this study

From: Evaluation of reference genes for real-time RT-PCR expression studies in the plant pathogen Pectobacterium atrosepticum

Gene Forward primer (5' – 3') Reverse primer (5' – 3') Amplicon
ffh ATGGGCGATGTGCTTTCACT TCAAACCCATCGCCTTTCTT 101
glnA TCCAGCAGCTAACCCGTACC GGTTTTTGTCCATCGCATCG 101
gyrA CTGCCGTGAGTGAGTACCCA AACCTGAACCGCACCAACC 101
proC CACAGCTGATGCAGAGCGTC GAAGAAATAGGCCGGTGCG 101
recA GGTGAGCTGGTTGATCTGGG GCATTCGCTTTACCCTGACC 101
rho TGACTGTGTGCTGATGGTGCT CGTCAAACGTTGACGCAATG 101
rplI ACCATCGCGTCTAAAGCAGG TTAGCAATGTCAACACCGGC 101
rplQ CAAGACCGACAGCGTTGCTA CGGGCCCAGTTCATTAAACA 91
topA TGCGTATTTCGTATTGCGTGA TCTTCTACCAGCGGTGCCC 96
tsx CTCTCTGATGGGCGGTAACG TGGAGTTGTTAGTGCGGCTTG 101
malE TCCGCTGATTAAGGATGACGA GCGTCCAAACTTCCTGCATT 101
16S CAATATTCCCCACTGCTGCC CACCTAGGCGACGATCCCT 101