Figure 2

PCR amplification of the microsatellite (CGA)4 within the EST-clone ve_002b_h12 in eight selected and representative Lolium perenne F2 genotypes of the VrnA mapping population [6]. Lane 1: 100 bp ladder DNA-marker; lane 2: NV#20/30-39/008; lane 3: NV#20/30-39/018; lane 4: NV#20/30-39/091; lane 5: NV#20/30-39/102; lane 6: NV#20/30-39/119; lane 7: NV#20/30-39/224; lane 8: NV#20/30-39/392; lane 9: NV#20/30-39/438. The primers used were G05_132_L1 (CAGATGCGCATGTCCTACAG) and G05_132_R1 (CTTGCTCTTGTCCGAATCGT). PCR and electrophoresis was performed as described previously [6].