Skip to main content

Table 2 Primers and characteristics of microsatellites loci.

From: Microsatellite diversity and broad scale geographic structure in a model legume: building a set of nested core collection for studying naturally occurring variation in Medicago truncatula

Locus Motif Origin Function Primer sequences (5'-3') Temp Linkage group Genebank Accession
FMT 07 [GA]28 GL Non coding GCAGAGAAAAGTAACACCATC
CAGGTTCTTTCTTACTTTCCC
60 7 AY294632
FMT 08 [CT]16 [CA]7 GL Non coding CAATCACTGGAAGCAAGGT
AGCCTGCTCATTTGTATTGC
55 7 AY294633
FMT 11 [GA]16 GL Non coding GGCCCAACCACAATTTC
CATAACTTCCAATAACTGCCA
55 1 AY294635
FMT 50 [GA]10 GL Non coding TAGGGACTTGAGGGGGTG
CAATATCGTAACACATGGCTC
60 3 AY294640
FMT 90 [GA]12 GL Non coding GGATGATGAAGACAATGTTAGCA
AGAAGTTATAGAGGGACGAAATTAG
60 1 AY294642
FMTBN1 [TA]6 GB Non coding TGTCAATTTCAGTGTTTGCT
AGTAAATGACAATAAGGAGT
50 5 AC126010
MAL367466 [TTC]8 GB Unknown ACACAAACAAACATTCTCAC
CATCGGTTGTTAGAGAGAG
60 2 AL367466
ENPB1 [AC]6 GB ENBP 1 gene CACTTCCCACTGTCCTAGTCCTAC
GACTCGTCATCACCAGTTTCATCC
55 1 AJ002479
MTIC37 [AAG]10 GB Unknown AAGAGCAAGCAAGAGGATGC
TCTTGGCCATTACAATATCATCA
55 4 AL373844
MTIC59 [AAG]6 GB Unknown CAAATTTGGAGAAGGCGAAG
CGGTCTCTTCATATTCGCTGA
55 5 AL377524
MTIC126 [AC]8 GB Unknown CCCAGTTGCAGACTCTCTCA
GAAGGGTTTACCGGAGGAAG
50 6 AL368250
MTIC243 [TTG]6 GB Unknown GGAGGAGGTTATAGGTTTGG
TCAGTGCTCAGCATCTATGT
50 6 n.a.
MTPG85C [TC]11 [AC]8 GL Non coding CCAACACAGTCACCTAACCAA
GTTTCTCCATTGTTTCGTAGG
50 ? AF274878
  1. Microsatellite motif was determined based on the sequence of a cloned allele. Microsatellite loci were obtained from microsatellite-enriched genomic libraries (GL) or using sequence information retrieved from GenBank (GB).
  2. Temp: optimal annealing temperature for the PCR amplification
  3. n.a. non available