Skip to main content

Advertisement

Table 2 Primers used. Sequences of the primers used for cloning of the promoter and gene fragments, for PCR screening of the putative transgenic plants, and for Real Time quantification of transcript levels. For further details, see Methods.

From: Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of lycopene epsilon cyclase

Primer name Sequence Use
B33-149 Up ACATATTTTACTTTTGACTTT B33 cloning
B33-1950 Dw GTAGTGTCACACTTACGC B33 cloning
B33 Up AGTCGACAATCATTGTTTTATTTTCTCTTTC B33 cloning
B33 Dw AGGATCCAAATTTTGTTGGTGCTTTGAG B33 cloning
Lcy-e 322 Up AGAGCTCGGCTGTGGTCCTGCTG Lcy-e cloning
Lcy-e 1085 Dw AGGATCCTGGCAAAGATCCACCAAC Lcy-e cloning
Lcy-e 574 Up TAGGATCATCATCATCAAG Pcr screening
Nos-test2 CGCGTATTAAATGTATAATTG Pcr screening
Tub 865 Up CTGTGAATTTAATCCCCTTG Pcr screening
Tub 1260 Dw TGCGCCTGAACATGGCAGT Pcr screening
Tub Up CAGACCTGAGGAAATTGGCTG Real Time assay
Tub Dw TTCTTGGCATCCCACATTTGT Real Time assay
Ubi Up ACAATGTCAAAGCCAAGATCCA Real Time assay
Ubi Dw CGGAGACGGAGCACGAGA Real Time assay
AS-e Up CCCCAATTTAGCAGACTCCG Real Time assay
AS-e Dw CAACAGAAATTATATGATAATCATCGCAA Real Time assay
Psy1 Up CGGTCTGCTATTGTTGCTACTCC Real Time assay
Psy1 Dw CAGGAACAGGTATGTCTGGCTTC Real Time assay
Psy2 Up AGCTTTAGATAGGTGGGAGGCA Real Time assay
Psy2 Dw CAAGTCCATACGCATTCCTTCAA Real Time assay
PDS Up AGAGACTTTGCATGCCGATTGT Real Time assay
PDS Dw AAAGCATCGCCCTCAACTGT Real Time assay
ZDS Up TTGCCATGTCAAAGGCCA Real Time assay
ZDS Dw ACAGGCACTCCGACCAATTT Real Time assay
CrtIso Up TTGGCAGCAGTAGGACGTAAAC Real Time assay
CrtIso Dw TCCCTTCCTTTTCATGTGGAA Real Time assay
Lcy-e Up GCCAAAATGGATGTGGCAG Real Time assay
Lcy-e Dw CAATGTTGCACCAGTAGGATCAG Real Time assay
Lut1 Up CGTTCTCCGCCCAAAAAAC Real Time assay
Lut1 Dw TTGGCCTAAAGTAAGTGACCTGG Real Time assay
Lcy-b Up AATGGGTGGTCCACTTCCAGTA Real Time assay
Lcy-b Dw GGATGGATGAACCATGCCAG Real Time assay
Chy1 Up CTTGGCCCAAAACCCACTT Real Time assay
Chy1 Dw CCTCAAATTGAGGTTTCAGCTTCT Real Time assay
Chy2 Up TTTTGCTGTCTCGAAGAAAGCC Real Time assay
Chy2 Dw AGCCAACAGGCAGCTAAACTCT Real Time assay
ZEP Up TCATGAATGCTGGCTGCATC Real Time assay
ZEP Dw TGCTGCAAAGTCATGCGG Real Time assay