Skip to main content

Table 1 Oligonucleotide Sequences. Sequences of oligonucleotides used in these experiments not published elsewhere. Primer sets are given for each transcript with the upper sequence being the forward primer and the lower being the reverse primer.

From: Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

# Transcript 5' Sequence 3' Name
1 TC84976 GGCAAGTTGCGTTCTGTAAACGG TC84976F1
2   TCGACGAATACGACGATAATCAC TC84976R1
3 TC90812 TTTGCAGCACTTCAAGCATGGTG TC90812F1
4   TTACCCAAAATGTGGAGAAGAAG TC90812R1
5 TC92226 GAATTACTTGTCGATGAGTCGTC TC922F1
6   AAATTCTTGAGGTCTCTAGGGC TC922R1
7 TC85320 CATGAGATCTCTGTGCTTTGCG TC853F1
8   CTTTCTCCCTTTCGTTAACCTGC TC853R1
9 TM6 (TC90108) TCAGTATCAGAGTGCACTTGGAG TM6F1
10   AACTGATATCTTCAGGAGAGACG TM6R1
11 RIN (TC91451) GGCAAGCTTTATGAATTTTGCAG TC91451F1
12   GTAGCATCATGTGTTGATGGTGC TC91451R1
13 TM5 (TC101989) GCATGCTAAAGACGTTGGAGAGG TM5F1
14   TGATGATAGGAAAACCATTGAGC TM5R1
15 TM29 (TC99375) AAAGTGCAGCTATGGAACATTGG TM29F1
16   ATGCAAAGCTGAAGATAAAGGAC TM29R1
17 TC85646 AAAGAGACGAATATAAGTGCTCC TC85646F1
18   AGTTGGAAATCGCTTATTCCCAC TC85646R1
19 TC94540 ATGGCTAAACATGATGGTGCAGC TC94540F1
20   AAACTGTAAATCTCTCAATCCTC TC94540R1
21 TC89506 CGGTTCGATGCCGGCTCAGACG TC89506F1
22   TAATCTTGTAATAGTTGAGTCGC TC89506R1
23 LET12 (TC93975) AGCACCAGGTGAAGGTACAGGAG TC93975F1
24   TTACTGCTTGATTTCACCTGCAC TC93975R1
25 TC87219 TCTTACCCGGTCCTTATGTACCT TC87219F1
26   TCTAAGGGGCATTCGGTATATCAG TC87219R1
27 TC86074 ATCTGTCTATGGGATGTCACAGC TC86074F1
28   AGGAAGTATTAGGTTAACTGTACC TC86074R1
29 TC89462 TAGGACAGTTAGAGAACCTAGAG TC89462F1
30   AGTTTCAGCAAAGCAATGACTCC TC89462R1
31 TC95361 GTCAGAAGAAACAGAAAGAGCCG TC95361F1
32   TTGTAGTCATGTTTTAGCACCGC TC95361R1
33 YABBY2-like(TC89502) CTTCTGCAGCACAATTCTTGCGG TC89502F1
34   ATAGAGACCAATTGTTTTCTGAGG TC89502R1
35 TC85864 TCTGTTATGAATCCGGGTAGTCC TC85864F1
36   GATTACTCAATCTTGCTGATGCC TC85864R1
37 TC91525 ATTACATGGAGCTAGATATTCCG TC91525F1
38   ATTTTGTAACAGGTTTCTTCAGG TC91525R1
39 BE435419 CTATGGGACATGAAATACAAGGG BE435F1
40   ATGGCTTTCTTTTGGTTTATTGC BE435R1
41 TC93803 GGTTGCATAGATGTTGCATTCAG TC93803F1
42   CCCATGAGCTTCATAAGCCTGAG TC93803R1
43 TC85295 ATTGGAGAGAAGCATCAGTAGGC TC85295F1
44   AAGTGGAGAATCAATGCCCAGAC TC85295R1
45 LeEF-1(TC98347) TGGCCCTACTGGTTTGACAACTG alphaF1
46   CACAGTTCACTTCCCCTTCTTCTG alphaR1
  1. Sequences of oligonucleotides used in these experiments not published elsewhere. Primer sets are given for each transcript with the upper sequence being the forward primer and the lower being the reverse primer.