Skip to main content

Table 2 List of the amiRNA constructs, amiRNA names, amiRNA target sequences and target genes

From: Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

Construct amiRNA name amiRNA sequence (5′ → 3′) Target sequence* (5′ → 3′) Gene name (GenBank accession ID)
pPZamiRPPO1 amiRPPO1 UUGGUGACUGGUGCAAUUGAC GUCAAUUGCACCAGUCACCAA StuPPO1/POTP1/P2 (XM_006355177/M95196/M95197)
pPZamiRPPO2 amiRPPPO2 UUGCUAGCUGGCGGAAGUGAA UUCACUUCCGCCAGCUAGCAA StuPPO2/POT32 (U22921)
pPZamiRPPO3 amiRPPO3 UUGUUCACUGGGGGGAGUGUA UACACUCCCCCCAGUGAACAA POT33 (U22922)
    UUCACUCCCCCCAGUGAACGA StuPPO3 (XM_006365320)
pPZamiRPPO23 amiRPPO23 UCAUCAACUGGAGUUGAGUUG CAACUCAACUCCAGUUGAUGA StuPPO2/POT32
    CAACUCAACUCCAGUUGAUGA StuPPO3/POT33
pPZamiRPPO234 amiRPPO234 UAGAACUCGGAGUUCAACCAA UUGGUUGAACUCCGAGUUCUA  
    UUGGUUGAACUCCGAGUUCUU StuPPO2/POT32
    UUGGUUGAACUCCGAGUUCUU StuPPO3 (XM_006365320)
    UUGGUUGAACUCUGAGUUCUU POT33 (U22922)
    UUGGUUGAACUCCGAGUUCUU StuPPO4/POT72 (U22923)
pPZamiRPPO234A amiRPPO234A AAGAACUCGGAGUUCAACCAA UUGGUUGAACUCCGAGUUCUU StuPPO2/POT32
    UUGGUUGAACUCUGAGUUCUU StuPPO3/POT33
    UUGGUUGAACUCCGAGUUCUU StuPPO4/POT72
pPZamiRPPO1234 amiRPPO1234 UCAAGCUCAUUCGCAUUCACA UGUGAAUGCGAAUGAGCUUGA  
    UGUGAAUGCGGAUGAGCUUGA StuPPO1/POTP1/P2
    UGUGAAUGCAAAUGAGCUUGA StuPPO2 (XM_006365321)
    UGUGAAUGCGAAUGAGCUUGA POT32 (U22921)
    UGUGAAUGCGAAUGAGCUUGA StuPPO3/POT33
    UGUGAAUGCGAAUGAGCUUGA StuPPO4/POT72
  1. Note: * The non-identical nucleotides, compared to the target sequence, are marked in bold. The homologous sequences of the predicated PPO-like gene models (StuPPO1 to StuPPO9) to all amiRNA target sequences are aligned in the Additional file 1: Part D.