Skip to main content

Table 4 Primers used for RT-qPCR

From: Secretions from the ventral eversible gland of Spodoptera exigua caterpillars activate defense-related genes and induce emission of volatile organic compounds in tomato, Solanum lycopersicum

Genes Direction Primer sequences (5′-3′) GenBank (AN) References
AOS Forward GGGTGAAATCCTATTCGGGT AF230371 [68]
Reverse CGCACTGTTTATTCCCCACT
LOX2 Forward TGCAACACGCACCATTTATT U37840 [50]
Reverse GTGACAACACGTTTGGATCG
TPS5 Forward CTATTTCCACCACAAGGCGT AY840091 [37]
Reverse TTCATCATGTGATCCCTCCA
TPS12 Forward GCCCAATGGTTAAACAATGATAATC JN412092 [37]
Reverse ATATAACGTGTTTATCACGCGTGTG
TPS25 Forward GTGGGTCAACTTCTGTAAAGCTTTAC JN412085 [37]
Reverse TGATTAACAATTTTTTTCTGTGATGTT
TPS7 Forward CAAGGAGTATGTTAATGTCAGG JN412082 [37]
Reverse GCTTCATATAAGTTCAATATTCC
  1. Allene oxide synthase (AOS), Lipoxygenase (LOX2), Tomato monoterpene synthase 5 (TPS5), Tomato terpene synthase 9 (TPS9), and Tomato terpene synthase 12 (TPS12). Accession number = AN.