Skip to main content

Table 5 Oligonucleotide primer sequences used in qPCR and in reverse-transcription PCR assays

From: Expression-based and co-localization detection of arabinogalactan protein 6 and arabinogalactan protein 11 interactors in Arabidopsis pollen and pollen tubes

AGI ID primer ID Forward primer Reverse primer
At4g05320 UBQ10 gctccgacaccattgacaac acgcaggaccaagtgaagag
At1g71380 ATCEL3 tctccaagtcattgctcttcttcc cgttgtctcctgcgtcatagtac
At3g60570 ATEXPB5 gcaaacggtgatgggaacttcg ggacacggcggaggtaagc
At5g11110 ATSPS2F tggtggtgttcgtgggagattcag ttagcctcggtgatgttgggactg
At1g53540 HSP17.6C-CI ggcaaacgcacccgctatg ttcacctcttccttcctcagtcc
AT2g46500 AT2g46500 agacggctcaaacgctcagaatc cggatagggcttcgaggaatgc
At2g39890 PROT1 atggcgagaggcgggtac gtggttggctagaatgaatgtgag
At1g50490 UBC20 agatcctccggcgtctaatgg tgcttcctgttattgtccctttcc
At5g60250 AT5g60250 cggttacagatggaggaggcactc aggacaccacacgtagccacaatc
At1g68610 At1g68610 ctctaacgaccaaccaagccaag acatcgctccgctcacacc
At4g27960 UBC9 gtttcaccaccctttcttc aaatcccacgatcaaattcc
At2g19970 At2g19970 gagacattctgatggaccttacg tccgagacttaacgattgattgg
At1g65760 At1g65760 cgatgattcctacattagcagac aagacgcaacgggtaacg
At2g22340 At2g22340 gcgacggtgggatttcaggaactg gatgggagcggcaacggatgtg
At5g28380 At5g28380 aagcacactgcgaccaaggc cagcggctcatggatctcactac
At4g09950 At4g09950 ggaggatgtgaaggagcaattagc tcttgttgagttcggtgcgtaac
At1g12840 DET3 cggcgttcttggcatgtgtc agcaaggttgatagtgaaggagac
At1g51490 BGLU36 gccgtactctctcgctgtcaaag atgagccagaagttcgtgatgtcc
At3g57880 C2 domain-containing protein caggatgaggtatrgacaggttgag gcggcaatcaagcagaacaag
At4g20780 CML42 cccaagcctaaacgcacttcg acggtggatttgagatcggagag
At2g19970 CAP (Antigen 5) gagacattctgatggaccttacg tccgagacttaacgattgattgg
At2g19980 CAP (allergen V5) gcacagaggtacgctaacg ggtggcataattgtaataaggc