Skip to main content

Table 4 Primers used for real-time PCR analysis

From: Energy status of ripening and postharvest senescent fruit of litchi (Litchi chinensis Sonn.)

Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’) Product (bp)
LcAtpB GAGAGTTGGTTTGACTGCCCTAA GAAGGCATTCTACCCAATAAGGC 141
LcAOX1 TCGGCTATCACTAAGATGTTGGTCA ACAAGCACACACTCAACGGATTTAC 149
LcUCP1 AGTTGGCGGTGATTTTATTGGAG GCATTCAAGGTCCCATAATAACG 177
LcAAC1 CTGAAGAATGAGGGTGCCAAGTC CTAAAACAGCGAAAGGAATACCG 171
LcSnRK2 AGTTGAAGGACATCTGCTTGGAA ATGCGAAAACCATACCTGTGTCA 153
  1. See legend for Table 2 for names of genes.