Skip to main content

Table 2 Mature sequence and precursor sequence conservation of novel miRNA

From: Genome-wide characterization of microRNA in foxtail millet (Setaria italica)

miRNA precursor miRNA sequence Conserved precursor Conserved miRNA family
nov-sit-MIR105 GCTCACTCCTCTTTCTGTCAGC sbi-MIR156a/e miR156
nov-sit-MIR103 GCTCACTTCTCTGTCTGTCAGC sbi-MIR156f miR156
nov-sit-MIR16 TTGACAGAAGAGAGCGAGCAC sbi-MIR156a miR156
nov-sit-MIR117 CGTGCTCACTACTCTTTCTGTC sbi-MIR156g miR156
nov-sit-MIR60 TCGGACCAGGCTTCATTCCCCA sbi-MIR166b miR166
nov-sit-MIR05 TTTCGGACCAGGCTTCATTCC sbi-MIR166c miR166
nov-sit-MIR58-2 TCGGACCAGGCTTCATTCCCCT sbi-MIR166a/j miR166
nov-sit-MIR58-3 TCGGACCAGGCTTCATTCCCCT sbi-MIR166j miR166
nov-sit-MIR77-2 TAGCCAAGAATGACTTGCCT sbi-MIR169i miR169
nov-sit-MIR32 TTAGCCAAGAATGGCTTGCCTA sbi-MIR169q miR169
nov-sit-MIR14 TTGAGCCGCGTCAATATCTCC sbi-MIR171h miR171
nov-sit-MIR49 TGAGCCGAGCCAATATCACT sbi-MIR171c miR171
nov-sit-MIR50 TGAGCCGAACCAATATCACTC sbi-MIR171e/f miR171
nov-sit-MIR148 AGTGGATGGCGCGGGAGCTAA sbi-MIR319b miR319
nov-sit-MIR114 CTGAAGTGTTTGGGGAACTC sbi-MIR395a miR395
nov-sit-MIR123 CGCCAAAGGAGAATTGCCCTG sbi-MIR399b/h miR399
nov-sit-MIR101 GGCAGCTCTCCTCTGGCAGG sbi-MIR399d miR399
nov-sit-MIR89 GTGCGGTTCTCCTCTGGCATG sbi-MIR399h miR399