Skip to main content

Table 1 PCR primers for detecting vernalization response and Ppd-D1 alleles in bread wheat

From: Molecular characterization of vernalization and response genes in bread wheat from the Yellow and Huai Valley of China

Name Allele or haplotype Forward primer Reverse primer Expected band size (bp) Annealing temp. °C Reference
Vrn_P1 vrn-A1/Vrn-A1a/Vrn-A1b/Vrn-A1c GAAAGGAAAAATTCTGCTCG TGCACCTTCCC(C/G)CGCCCCAT 950 + 876 or 714 or 734 50 [9]
Vrn_P2 Vrn-A1b CCTGCCGGAATCCTCGTTTT CTACGCCCCTACCCTCCAACA 147 or 167 63 In this paper
Vrn-P3 Vrn-A1c AGCCTCCACGGTTTGAAAGTAA AAGTAAGACAACACGAATGTGAGA 1170 65 [20]
Vrn-P4 vrn-A1 GCACTCCTAACCCACTAACC TCATCCATCATCAAGGCAAA 1068 59 [20]
Vrn-P5 Vrn-B1a CAAGTGGAACGGTTAGGACA CTCATGCCAAAAATTGAAGATGA 709 63 [20]
Vrn-P6 vrn-B1 CAAGTGGAACGGTTAGGACA CAAATGAAAAGGAATGAGAGCA 1149 58 [20]
Vrn-P7 Vrn-B1b CCAATCTCACATGCCTCCAA ATGCGCCATGAACAACAAAG 215 or 252 59 In this paper
Vrn-P8 Vrn-D1a GTTGTCTGCCTCATCAAATCC GGTCACTGGTGGTCTGTGC 1671 63 [20]
Vrn-P9 vrn-D1 GTTGTCTGCCTCATCAAATCC AAATGAAAAGGAACGGAGCG 997 59 [20]
Vrn-P10 Vrn-D1b GTTGTCTGCCTCATCAAATCC AGGATGGCCAGGCCAAAACG 612 bp 60 [28]
Vrn-P11 Vrn-D1b GTTGTCTGCCTCATCAAATCC AGGATGGCCAGGCCAAAACT 612 bp 60 [28]
Vrn-P12 vrn-B3 ATGCTTTCGCTTGCCATCC CTATCCCTACCGGCCATTAG 1140 or 2030 56 [9]
Vrn-P13 Vrn-B3a CATAATGCCAAGCCGGTGAGTAC ATGTCTGCCAATTAGCTAGC 1200 59 [9]
Vrn-P14 Vrn-B3c GCTTTGAACTCCAAGGAGAA ATAATCAGCAGGTGAACCAG 1401 52 In this paper
Vrn-P15 vrn-B3/Vrn-B3 ACTCATCATCACCACTTCCT TAATGCTTAATTCGTGGCTG 1499 51 In this paper
Vrn-P16 Vrn-B3 promoter GTCCATACAAATCATGCCAC TTCTGACAGTTTTAGTTGCG 491 51 In this paper
Vrn-P17 Vrn-B3 promoter GCTTTCGCTTGCCATCCCAT GCGGGAACGCTAATCTCCTG 898 62 In this paper
Vrn-P18 Vrn-B3 promoter TTTGAGACAGGAGATTAGCG ACCATCATGAGGCACCATTA 1131 53 In this paper
Vrn-P19 Vrn-B3 promoter GCTTTGAACTCCAAGGAGAA ATAATCAGCAGGTGAACCAG 1425 52 In this paper
Vrn-P20 Vrn-B3 promoter CCGTTCACCATCTATTGCTC CACCCAAATCCTTCATCTCA 1259 55 In this paper
Vrn-P21 CNV of Vrn-A1 CATTGTTCCTTCCTGTCCCACCC ATTACTCGTACAGCCATCTCAGCC 1431 63 [29]
Vrn-B3-RT - GGAGGTGATGTGCTACGAGA TTGTAGAGCTCGGCGAAGTC 147 55 In this paper
β-actin - GTTCCAATCTATGAGGGATACACGC GAACCTCCACTGAGAACAACATTACC 422 56 [30]
Ppd-P1 Ppd-D1a ACGCCTCCCACTACACTG CACTGGTGGTAGCTGAGATT 288 or 2377 54 [15]
Ppd-P2 Ppd-D1b ACGCCTCCCACTACACTG GTTGGTTCAAACAGAGAGC 414 or 453 54 [15]
Ppd-P3 16 bp insertion Exon 8 GATGAACATGAAACGGG GTCTAAATAGTAGGTACTAGG 320 or 336 52 [15]
Ppd-P4 TE deletion AGGTCCTTACTCATACTCAATCTCA CTCCCATTGTTGGTGTTGTTA 2612 50 [23]
Ppd-P5 2 kb deletion or TE insertion CCATTCGAGGAGACGATTCAT CTGAGAAAGAACAGAGTCAA 1005 55 [23]
Ppd-P6 5 bp deletion Exon 7 GAATGGCTTCTCCTGGTC GATGGGCGAAACCTTATT 1,032 or 1,027 50 [23]
Ppd-P7 5 bp deletion Exon 7 GTGTCCTTTGCGAATCCTT TTGGAGCCTTGCTTCATCT 184 or 179 53 [23]
Ppd-P8 Truncated Ppd-B1 gene in the ‘Chinese Spring’ allele TAACTGCTCCTCACAAGTGC CCGGAACCTGAGGATCATC 425 56 [31]
Ppd-P9 Intact Ppd-B1 copies in the ‘Chinese Spring’ allele AAAACATTATGCATATAGCTTGTGTC CAGACATGGACTCGGAACAC 994 58 [31]
Ppd-P10 Intact Ppd-B1 copies in the ‘Sonora64’/‘Timstein’ allele CCAGGCGAGTGATTTACACA GGGCACGTTAACACACCTTT 223 58 [31]