Skip to main content

Table 1 Novel miRNAs highly expressed in developing wheat grains

From: Development-associated microRNAs in grains of wheat (Triticum aestivumL.)

miRNA Sequence 5′ to 3′ Length (nt) Abundance (TPM) Target description (Accession No.)
5DAP 15DAP 25DAP 30DAP
Cluster I        
Ta-miR023b-5p UCGCAAAUAAUGGUGGCCCUCG 22 -- 6.09 9.21 12.05 Uncharacterized protein (GW667699; TC402735)
Ta-miR128-5p GUGGAUGAUGAGAUCACAAGUAA 23 -- 21.58 29.78 23.56 DRG1 (TC386119); Glycolipid transfer protein (CA648678); Polyol transporter 5 (CA681870).
Ta-miR113-5p UGGCUACUUCCUUUCCCUUGCC 22 -- 22.68 13.52 14.08 bZIP transcription factor (TC448705); Phytosulfokine receptor 1 (TC443080).
Ta-miR021-1-5p UCUGGCGAGGGACAUACACUGU 22 1.26 61.89 1771.23 7480.74 Protein Rf1 (DR736808); F-box protein PP2-A13-like (TC381152).
Cluster II        
Ta-miR018-5p UCUGUAAACAAAUGUAGGACG 21 2.22 24.55 8.69 59.25 CBL-interacting protein kinase (TC376281); P450 reductase (CK211052); Putative protein kinase (TC404251).
Ta-miR004-1-5p UCACAAAUAUAAGAUGUUCU 20 2.96 12.72 6.73 16.64 Sucrose-phosphate synthase (TC410332); Nectarin-3 (CA728499); CTD-phosphatase (TC373796); TIF3 (TC398757); receptor-like kinase (TC369729); Lipoyl synthase (TC458824).
Ta-miR034-3p AGGGGGCAAUCUCACCUCAAC 21 6.21 14.31 8.16 27.18 Serpin-Z2B (BQ243327)
Ta-miR036-3p UUCCGAAAGGCUUGAAGCAAAU 22 8.87 55.60 21.03 24.99 Light-induced protein (TC387010); SH3 domain protein (DR732608); Aquaporin TIP3-2 (TC390755).
Ta-miR044-1-3p UGAGAAGGUAGAUCAUAAUAGC 22 3174.59 5490.93 3890.60 9689.90 Mla-like protein (TC368609); NBS-LRR resistance protein (GH723128).
Cluster III        
Ta-miR042-3p UGAUUGAGCCGUGCCAAUAUC 21 -- 11.20 -- -- WD and FYVE containing protein 3 (TC418522); Papain-like cysteine proteinase (TC448847).
Ta-miR107-2-3p AAAAUACUUGUCGGAGAAAUG 21 -- 12.66 -- -- Uncharacterized protein (CA664743; DR734972; CK215832)
Ta-miR106-5p CGGUGGAGCUGGUUGAUGGAC 21 -- 141.21 -- -- MYB39 (BE497135); HD-ZIP ROC8 (TC459241); SRG1 (CD454006); alpha-glucosidase (TC393877).
Cluster IV        
Ta-miR154-5p GGCGAGGGACAUACACUGUACA 22 -- -- 1772.21 7485.33 Nucleoredoxin (CA605146)
Ta-miR051-3p AAUAAGUGUGUGAUUGCUACU 21 1.18 -- 10.19 15.73 Serine/threonine-protein phosphatase PP2A-4 (TC437472); BONZAI 3 (TC398798).
Cluster V        
Ta-miR068-5p CUCUCUCGGGAGGGCUGAUC 20 14.64 8.58 1.50 1.36  
Ta-miR057-1-3p UGGCCGUUGGUAGAGUAGGAGA 22 67.80 13.28 2.74 2.63 hypothetical protein (TC415409); ribosomal protein S14 (TC421110).
Ta-miR007-5p CUUAAUUUUGUAAUCUUCUGG 21 109.64 149.93 -- -- NBS-LRR protein (TC426546); superkiller viralicidic activity 2-like 2 (TC441282).
Ta-miR007-3p AGAAGAUUAGAAGAUUAAGCA 21 666.30 1234.41 -- -- V-type proton ATPase (TC454891); 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase (CV759216).
Cluster VI        
Ta-miR158-3p AAGACAACUAAUUUGGGACGG 21 -- -- -- 12.72 pre-mRNA-splicing factor (TC435842); receptor protein kinase (TC390384).
Ta-miR159-3p UGUAGAAAUAGGCACCGGUGC 21 -- -- -- 14.83 ATP sulfurylase (TC415167); DCN1 protein (TC382978); acetylglucosaminyltransferase (TC385422).
Ta-miR033-3p UCAAAGGAUGAGCAAAUACU 20 1.77 3.94 -- 10.09 Adenosylhomocysteinase (TC437024); met-10+ protein (TC423089); chaperonin (TC384436).
Ta-miR053-3p AGGUGGUUAGGAUACUCGGCU 21 1.85 4.15 1.83 10.62 Acetyl-CoA carboxylase (CK153030)
Ta-miR039-5p CAGAACCAGAAUGAGUAGCUC 21 18.93 -- 21.23 -- NAC (TC389150); Elongation factor 1 (TC380217); Ubiquitin-protein ligase (GH729553).
Ta-miR034-5p UGAGAUGAGAUUACCCCAUAC 21 85.17 75.79 56.76 163.67 F-box domain containing protein (TC411563); hypothetical protein (CJ660567).