From: Development-associated microRNAs in grains of wheat (Triticum aestivumL.)
miRNA | Sequence 5′ to 3′ | Length (nt) | Abundance (TPM) | Target description (Accession No.) | |||
---|---|---|---|---|---|---|---|
5DAP | 15DAP | 25DAP | 30DAP | ||||
Cluster I | Â | Â | Â | Â | Â | Â | Â |
Ta-miR023b-5p | UCGCAAAUAAUGGUGGCCCUCG | 22 | -- | 6.09 | 9.21 | 12.05 | Uncharacterized protein (GW667699; TC402735) |
Ta-miR128-5p | GUGGAUGAUGAGAUCACAAGUAA | 23 | -- | 21.58 | 29.78 | 23.56 | DRG1 (TC386119); Glycolipid transfer protein (CA648678); Polyol transporter 5 (CA681870). |
Ta-miR113-5p | UGGCUACUUCCUUUCCCUUGCC | 22 | -- | 22.68 | 13.52 | 14.08 | bZIP transcription factor (TC448705); Phytosulfokine receptor 1 (TC443080). |
Ta-miR021-1-5p | UCUGGCGAGGGACAUACACUGU | 22 | 1.26 | 61.89 | 1771.23 | 7480.74 | Protein Rf1 (DR736808); F-box protein PP2-A13-like (TC381152). |
Cluster II | Â | Â | Â | Â | Â | Â | Â |
Ta-miR018-5p | UCUGUAAACAAAUGUAGGACG | 21 | 2.22 | 24.55 | 8.69 | 59.25 | CBL-interacting protein kinase (TC376281); P450 reductase (CK211052); Putative protein kinase (TC404251). |
Ta-miR004-1-5p | UCACAAAUAUAAGAUGUUCU | 20 | 2.96 | 12.72 | 6.73 | 16.64 | Sucrose-phosphate synthase (TC410332); Nectarin-3 (CA728499); CTD-phosphatase (TC373796); TIF3 (TC398757); receptor-like kinase (TC369729); Lipoyl synthase (TC458824). |
Ta-miR034-3p | AGGGGGCAAUCUCACCUCAAC | 21 | 6.21 | 14.31 | 8.16 | 27.18 | Serpin-Z2B (BQ243327) |
Ta-miR036-3p | UUCCGAAAGGCUUGAAGCAAAU | 22 | 8.87 | 55.60 | 21.03 | 24.99 | Light-induced protein (TC387010); SH3 domain protein (DR732608); Aquaporin TIP3-2 (TC390755). |
Ta-miR044-1-3p | UGAGAAGGUAGAUCAUAAUAGC | 22 | 3174.59 | 5490.93 | 3890.60 | 9689.90 | Mla-like protein (TC368609); NBS-LRR resistance protein (GH723128). |
Cluster III | Â | Â | Â | Â | Â | Â | Â |
Ta-miR042-3p | UGAUUGAGCCGUGCCAAUAUC | 21 | -- | 11.20 | -- | -- | WD and FYVE containing protein 3 (TC418522); Papain-like cysteine proteinase (TC448847). |
Ta-miR107-2-3p | AAAAUACUUGUCGGAGAAAUG | 21 | -- | 12.66 | -- | -- | Uncharacterized protein (CA664743; DR734972; CK215832) |
Ta-miR106-5p | CGGUGGAGCUGGUUGAUGGAC | 21 | -- | 141.21 | -- | -- | MYB39 (BE497135); HD-ZIP ROC8 (TC459241); SRG1 (CD454006); alpha-glucosidase (TC393877). |
Cluster IV | Â | Â | Â | Â | Â | Â | Â |
Ta-miR154-5p | GGCGAGGGACAUACACUGUACA | 22 | -- | -- | 1772.21 | 7485.33 | Nucleoredoxin (CA605146) |
Ta-miR051-3p | AAUAAGUGUGUGAUUGCUACU | 21 | 1.18 | -- | 10.19 | 15.73 | Serine/threonine-protein phosphatase PP2A-4 (TC437472); BONZAI 3 (TC398798). |
Cluster V | Â | Â | Â | Â | Â | Â | Â |
Ta-miR068-5p | CUCUCUCGGGAGGGCUGAUC | 20 | 14.64 | 8.58 | 1.50 | 1.36 | Â |
Ta-miR057-1-3p | UGGCCGUUGGUAGAGUAGGAGA | 22 | 67.80 | 13.28 | 2.74 | 2.63 | hypothetical protein (TC415409); ribosomal protein S14 (TC421110). |
Ta-miR007-5p | CUUAAUUUUGUAAUCUUCUGG | 21 | 109.64 | 149.93 | -- | -- | NBS-LRR protein (TC426546); superkiller viralicidic activity 2-like 2 (TC441282). |
Ta-miR007-3p | AGAAGAUUAGAAGAUUAAGCA | 21 | 666.30 | 1234.41 | -- | -- | V-type proton ATPase (TC454891); 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase (CV759216). |
Cluster VI | Â | Â | Â | Â | Â | Â | Â |
Ta-miR158-3p | AAGACAACUAAUUUGGGACGG | 21 | -- | -- | -- | 12.72 | pre-mRNA-splicing factor (TC435842); receptor protein kinase (TC390384). |
Ta-miR159-3p | UGUAGAAAUAGGCACCGGUGC | 21 | -- | -- | -- | 14.83 | ATP sulfurylase (TC415167); DCN1 protein (TC382978); acetylglucosaminyltransferase (TC385422). |
Ta-miR033-3p | UCAAAGGAUGAGCAAAUACU | 20 | 1.77 | 3.94 | -- | 10.09 | Adenosylhomocysteinase (TC437024); met-10+ protein (TC423089); chaperonin (TC384436). |
Ta-miR053-3p | AGGUGGUUAGGAUACUCGGCU | 21 | 1.85 | 4.15 | 1.83 | 10.62 | Acetyl-CoA carboxylase (CK153030) |
Ta-miR039-5p | CAGAACCAGAAUGAGUAGCUC | 21 | 18.93 | -- | 21.23 | -- | NAC (TC389150); Elongation factor 1 (TC380217); Ubiquitin-protein ligase (GH729553). |
Ta-miR034-5p | UGAGAUGAGAUUACCCCAUAC | 21 | 85.17 | 75.79 | 56.76 | 163.67 | F-box domain containing protein (TC411563); hypothetical protein (CJ660567). |