Skip to main content

Table 3 Primers used in the RT-PCR experiment

From: Arabidopsis nonhost resistance gene PSS1confers immunity against an oomycete and a fungal pathogen but not a bacterial pathogen that cause diseases in soybean

Gene 1Primer Amplicon
PsAvh223 F:GGCCACCCACACACCCCTCCCTCCCGTC 237
  R:CGGCGTCCTCGGCCTCGTCGTCTAG  
PsAvh224 F:GCGCGGCCTCGAGTTCCTTCTTCGTG 355
  R:CCTCCCTCCCGTCCGCTACAGTCATG  
AtActin F:GGCGATGAAGCTCAATCCAAACG 491
  R:GGTCACGACCAGCAAGATCAAGACG  
  1. 1Primers: F, forward primer; R, reverse primer