Skip to main content

Table 1 Primer sequences used for qRT-PCR experiments

From: Comparative analyses reveal potential uses of Brachypodium distachyonas a model for cold stress responses in temperate grasses

Gene name forward primer 5′ > 3′ reverse primer 5′ > 3′ probe 5′ > 3′ product size (bp)
Bradi5g27300.1 ggctaccggacaaccaaata aacgttgttgtccccagtg ccggggccaacaactctgtca 109
Bradi5g27310.1 aacactgttatgggggagga ggatacgctattgttgctgcc tggggacaacaacgttgtgtctgg 120
Bradi5g27330.1 ttcgaaacaggttccttgct agcacacggaggtcatcg gcaataagcacggcggtggc 121
Bradi5g27350.1 aaccacaacaaaatcctaagtgg gttgtggctcctggtcacg tgccgtaagtggtcacatgcatg 117
BradiGAPDH ggtgccaagaaggttgtcat ggtgccaagaaggttgtcat gcacccagcaaagatgctccc 190