Skip to main content

Table 2 Tomato orthologues of candidate regulatory genes for L-ascorbic acid metabolism

From: Regulation of fruit ascorbic acid concentrations during ripening in high and low vitamin C tomato cultivars

Gene Reference Gene inArabidopsis Unigene Name F-primer (5-3) R-primer (5-3)
L-galactose pathway
GDP-mannose pyrophosphorylase At2g39770 SGN-U568548 SlGMP1 CAGGTAGCATTATCGGTTGG TTGATCTCCTTGTGGGGTAA
SGN-U568547 SlGMP2 GTGTAGTTTTGCCCCACAAG AGGAGAACTGGAAACCAACC
SGN-U584300 SlGMP3 AGAAGCGACTGGGAGAGTTG GAATCCGGTCCAAAACAGAA
GDP-mannose-3,5-epimerase At5g28840 SGN-U581327 SlGME1 TTCCTGTCCAACACATTCCT CTTTCTCGATCTGCTCCTTG
SGN-U580362 SlGME2 ATTCGAGATGTGGGGAGATG GGAAGGTTCTTGCCATCAAA
GDP-L-galactose phosphorylase At4g26850 SGN-U579800 SlGGP1 TCCAAGTGTCGTTGCCATAA TCGGAAGTAAGGGTTTGCTG
SGN-U573852 SlGGP2 GCTCTCCATTTTGCCAGAGA CCCCTTCCTTGCCAGTATTT
L-galactose-1-P-phosphatase At3g02870 SGN-U600217 SlGPP1 TGGTGGCGCTGTAATAGTGA AACGCTTCCTTGAGATGAGG
SGN-U568299 SlGPP2 AGGTCCCTTCGTATGTGTGG GAACCCTCCAGCTTCTTTCA
L-galactose dehydrogenase At4g33670 SGN-U565558 SlGalDH AGTAGCAACGACTGGAATGG TGCACAACAGGAGATCACAA
L-galactonolactone dehydrogenase At3g47930 SGN-U585649 SlGLDH AGATTGAGGTTCCCAAGGAC TTAGATAGGATGCGGTTTGG
AsA recycling pathway
Monodehydroascorbate reductase At1g63940 SGN-U583672 SlMDHAR1 CAAGGGTTTCGGTTCCTTCT CTGCATTTCCTCCTCCAACT
At3g52880 SGN-U573751 SlMDHAR2 AGATCGTTGGTGCATTCCTC AAAACTGATGCCCTCCTGTG
At3g27820 SGN-U584073 SlMDHAR3 AGGAATGGAATGTGCTGCTT GACCGTGCCTTTCACAAACT
Dehydroascorbate reductase At1g19570 SGN-U583361 SlDHAR1 AGGTGGCTCTTGGACACTTC CTTCAGCCTTGGTTTTCTGG
At5g16710 SGN-U577467 SlDHAR2 CACCCAGAGGGTTTTGCTTA CTCCAGTGCCTGTGAGATGA
  1. Details of the gene ID, the corresponding unigene, and the forward and reverse primers used in gene expression studies throughout ripening are shown.
\