Skip to main content

Table 1 Primers used for PCR and RT-PCR amplification of Arabidopsis CAN1 and CAN2 cDNAs

From: Plant plasma membrane-bound staphylococcal-like DNases as a novel class of eukaryotic nucleases

primer name sequence
CAN1For 5’AAATGGGTAACGCGATTAGG3’
CAN1Rev 5’CATTAATTGCCTCCACGTTTG3’
CAN2For 5’TGGGTGAAAGATGGGTAACG3’
CAN2Rev 5’CCCTCAACAATCACAAATCTCA3’
CAN1Sal 5’ACCGTCGACATGGGTAACGCGATTAGGTTA3’
CAN1Bgl 5’GGGAGATCTGATTGCCTCCACGTTTGTTCT3’
CAN2Sal 5’GTTGTCGACATGGGTAACGCTCTTACGTTT3’
CAN2Bgl 5’CCCAGATCTGTTCCCGCCTATTATTCTTTC3’