Skip to main content

Table 2 Identification of novel microRNAs in wild soybean

From: Identification of wild soybean miRNAs and their target genes responsive to aluminum stress

miR_namea Sequenced sequence Length genome ID strand dG CG% MFEI raw_Al-free raw_Al-treated Glycine maxGenomeb Glycine sojaGenomec
PCd-1-5p TGGCCTGTGATGCATCAATTTGTC 24 Gm12 + −26.6 44 0.7 49 10 yes no
PC-1-3p GTCTCTGATGAATGCTCAAATTCT 24 Gm12 + −26.6 44 0.7 7 11 yes no
PC-4-5p GTCGTTGTAGTATAGTGGTAAGT 23 Gm05 + −33.5 37.3 0.7 26 8 yes yes
PC-4-3p GTCGTTGTAGTATAGTGGTAAGTA 24 Gm05 + −33.5 37.3 0.7 84 48 yes yes
PC-8-5p ATTGTTGAGACGATTCTGTAGACG 24 Gm09 + −16.8 28.3 0.6 12 9 yes no
PC-12-5p AAATCTACATGCGGATCAAGTTGA 24 Gm17 + −34.2 39.7 1.1 0 12 yes yes
PC-20-3p CAACGGTCATAATGTAGATTTA 22 Gm05 + −29 40.6 0.7 10 16 yes yes
PC-21-5p CAAAGATTCATCGTAGGCTAGACT 24 Gm08 + −25.1 55.4 0.7 14 12 yes yes
PC-25-3p CTACATAAGGCACGAGATCATC 22 Gm18 - −17 38.2 0.7 7 29 yes yes
PC-26-3p CATCGGTCGAGAGCGTTCTT 20 Gm06 - −48.8 46.2 0.9 14 6 yes no
PC-28-3p CATTTGGGCACCTATTTTGACTC 23 Gm06 + −18.8 40 0.8 24 2 yes yes
PC-32-3p TATATTCGGATATTCACATT 20 Gm02 + −26.7 34.3 0.8 15 10 yes no
PC-33-3p GGAGAACAAAGAAGCAGCTAAATTC 25 Gm16 + −22.4 32.6 0.7 4 29 yes no
PC-35-5p AAAAGGACACATGACTCACACCTA 24 Gm10 - −11.9 31.2 0.5 10 10 yes yes
PC-36-5p GAGTTGGCGAGTTGGACACGTGGC 24 Gm08 - −38 59.5 0.8 9 12 yes no
PC-39-5p TAGATTTTAAAGTTGCGGATCA 22 Gm04 - −42.3 38.5 1.1 10 32 yes yes
PC-40-3p AATACGTAAGGCTTGAGCTTGACT 24 Gm01 - −37.8 42.9 1 8 17 yes yes
PC-41-3p AAATCAGATGATATGGACTTAAAT 24 Gm13 - −21.2 28.3 0.8 19 20 yes yes
PC-42-5p AAGAAACGTTGACTCTCCGTGTT 23 Gm03 - −39.9 38.5 0.8 11 5 yes no
PC-43-5p ATCGGGATGCTCAGTTCGCATGGT 24 Gm10 + −33.9 46.6 1 5 11 yes yes
PC-44-3p ATGAACCCTTTGAGATCACTGGTT 24 Gm06 - −26.2 47.1 0.7 17 13 yes yes
PC-45-5p AGACGGTAAGAAGAGAATTTCAAT 24 Gm01 - −14.3 23.8 0.8 11 4 yes yes
PC-46-5p CTATATGATGAAGATA 16 Gm18 + −28.3 34 0.9 52 26 yes yes
PC-47-3p CGTTGTAGTATAGTGGTAAGTATT 24 Gm19 + −31.1 46 0.5 9 11 yes yes
PC-48-3p TTAGCTTCTTTCACCTTTCCC 21 Gm17 - −41.8 41.5 1.2 135 137 yes no
PC-52-5p TGAGGGCAAAGATATTAGAGAA 22 Gm05 - −26 35.9 0.7 5 12 yes yes
PC-56-3p GGCGAGGAATCTGGGCTCATT 21 Gm15 + −37.5 47.6 1 16 19 yes yes
PC-57-3p GCATACAGGGAGTCAAGCAGA 21 Gm09 - −48 43 1.2 20 27 yes no
PC-58-5p TTAGTTGAATGGTACTGTAGTAGT 24 Gm06 + −29.2 37 0.7 6 11 yes yes
PC-60-3p TTTCCCGGCAATGGAACCA 19 Gm17 + −19.3 38 0.5 298 208 yes no
PC-61-5p AACTTACTGACTCGTTGACTCGGT 24 Gm14 + −21.1 39.4 0.8 10 5 yes yes
  1. Genomic locations of the pre-miRNA are based on the Glycine max assembly Gmax_109_repeatmasked.fa downloaded from ftp.plantgdb.org/download/Genomes/GmGDB/. Identification of known miRNAs was based on miRBase 18.0.
  2. a, miR_name is the name that was assigned to the detected miRNA sequences.
  3. b, G. max Genome is the precursor sequences whether they could be mapped to Glycine max [56].
  4. c, G. soja Genome is the precursor sequences whether they could be mapped to Glycine soja EST or GSS [92].
  5. d, PC means 'predicted candidate'.