Skip to main content

Table 2 Transposon- or repeat-derived miRNAs and other known miRNAs that were regulated with abiotic stresses

From: High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice

MiRNA Family *Log2 (Drought/Ctrl) *Log2 (Cold/Ctrl) *Log2 (Salt/Ctrl) Putative target
UGGAUGUGACAUACUCUAGUA osa-cand066 0.72   1.27 0.42   LTPL8 - Protease inhibitor
UGGGAUACUGAUGUCGAGGUCGAG osa-cand084 −1.25 −2.33 −1.12 Transposon protein
AUAAGACGGACAGUCAAAGUUGGA osa-cand085 −0.68   −0.71   −1.26 Expressed protein
AAUGUAUGACGCUGUUGACUUUUA miR1884 −1.38 −0.77   −0.15   AAA ATPase
AUGAAUGUGGGCAAUGCUAGAAAG miR809 −0.59   −1.54 −0.77   Glutaredoxin 2, putative
AUGAAUGUGAGAAAUGCUAGAAUG miR809 −0.62   0.31   −2.08 Glutaredoxin subgroup II
UAUGAAUGUGGGCAAUGCUAGAAA miR809 −1.35 −0.88   −0.71   PPR repeat containing protein
TGAACACCGATATGCGTCATC miR810b.1 1.10 0.76   0.25   Unknown
AAGTGATTTAATTATGCCGTT miR810b.2 0.96   1.51 0.17   Unknown
TATGGATGGAGGTGTAACCCGATG miR1874-3p −3.20 −3.40 −0.62   Unknown
AGATGACATGTGAATGATGAGGGG miR1877 −3.61 −8.34 −0.83   Unknown
  1. *Log2 ratio of normalized miRNA expression in stress and control libraries. Ctrl: control condition; ↑ and ↓: up- and downregulated in stress, respectively.