High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice

BMC Plant Biology

Table 2 Transposon- or repeat-derived miRNAs and other known miRNAs that were regulated with abiotic stresses

MiRNA	Family	*Log2 (Drought/Ctrl)		*Log2 (Cold/Ctrl)		*Log2 (Salt/Ctrl)		Putative target
UGGAUGUGACAUACUCUAGUA	osa-cand066	0.72		1.27	↑	0.42		LTPL8 - Protease inhibitor
UGGGAUACUGAUGUCGAGGUCGAG	osa-cand084	−1.25	↓	−2.33	↓	−1.12	↓	Transposon protein
AUAAGACGGACAGUCAAAGUUGGA	osa-cand085	−0.68		−0.71		−1.26	↓	Expressed protein
AAUGUAUGACGCUGUUGACUUUUA	miR1884	−1.38	↓	−0.77		−0.15		AAA ATPase
AUGAAUGUGGGCAAUGCUAGAAAG	miR809	−0.59		−1.54	↓	−0.77		Glutaredoxin 2, putative
AUGAAUGUGAGAAAUGCUAGAAUG	miR809	−0.62		0.31		−2.08	↓	Glutaredoxin subgroup II
UAUGAAUGUGGGCAAUGCUAGAAA	miR809	−1.35	↓	−0.88		−0.71		PPR repeat containing protein
TGAACACCGATATGCGTCATC	miR810b.1	1.10	↑	0.76		0.25		Unknown
AAGTGATTTAATTATGCCGTT	miR810b.2	0.96		1.51	↑	0.17		Unknown
TATGGATGGAGGTGTAACCCGATG	miR1874-3p	−3.20	↓	−3.40	↓	−0.62		Unknown
AGATGACATGTGAATGATGAGGGG	miR1877	−3.61	↓	−8.34	↓	−0.83		Unknown

*Log2 ratio of normalized miRNA expression in stress and control libraries. Ctrl: control condition; ↑ and ↓: up- and downregulated in stress, respectively.

ISSN: 1471-2229