Skip to main content

Table 1 The top 10 novel miRNAs predicted from both arms of the miRNA precursor

From: Characterization of the stress associated microRNAs in Glycine maxby deep sequencing

miRID Location Strand
(+/-)
Energy (kcal/mol) Sequence of 5p Sequence of 3p Mock (count) Drought (count) Salinity (count) Alkalinity (count)
       5p 3p 5p 3p 5p 3p 5p 3p
Gma-m001 Gm18:61442586:61442692 - -44.1 CTGACAGAAGATAGAGAGCAC - 3395 - 3248 - 4830 - 2216 -
Gma-m002 Gm02:837420:837549 + -56.5 CAGGGGAACAGGCAGAGCATG - 3672 - 2573 - 2945 - 3159 -
Gma-m003 Gm12:3176108:3176377 + -69.67 TCCATTGTCGTCCAGCGGTTA - 3282 - 3673 - 2931 - 1186 -
Gma-m004 Gm19:40699070:40699221 - -65.8 TGGGTGAGAGAAACGCGTATC TACGGGTCGCTCTCACCTAGG 367 879 491 1053 186 1083 125 329
Gma-m005 Gm14:5324794:5324912 + -44 AGCCAAGAATGACTTGCCGGAA CGGGCAAGTTGTTTTTGGCTAC 337 560 475 644 438 471 175 173
Gma-m006 Gm09:16565920:16566038 - -44.7 AGAGGTGTTTGGGATGAGAGA CCTCATTCCAAACATCATCTAA 1596 102 1695 138 777 128 335 53
Gma-m007 Gm18:61452908:61452997 - -41 GGAATGGGCTGATTGGGAAGT - 835 - 781 - 813 - 598 -
Gma-m008 Gm02:30498945:30499130 - -70.5 CTGGGTGAGAGAAACACGTAT ACGGGTCGCTCTCACCTGGAG 85 665 170 635 78 714 43 264
Gma-m009 Gm13:34382988:34383131 - -57.37 TCATTGAGTGCAGCGTTGATG TATTGACGCTGCACTCAATCA 332 811 187 744 202 340 142 227
Gma-m010 Gm06:10859290:10859391 - -33.76 - CGAGCCGAATCAATACCACTC - 658 - 693 - 515 - 355