Skip to main content

Table 1 Sequence of oligonucleotides used in this study

From: DOF-binding sites additively contribute to guard cell-specificity of AtMYB60promoter

Name Sequence
p60F1 AAGCTTCACAAGGACACAAGGACA
p60 F2b AAGCTTCAAGTTGCAGTGAATGA
p60F8b AAGCTTTAACGAGCTCCTTTTATGG
p60F9 AAGCTTCCATTTATGAGTTGATTATCA
p60F3 AAGCTTCGTGTGGAGATCAACAT
p60F5 AAGCTTGCAGAGTGACTCGTGA
p60R5 TCTCGGATCCTCTAGATCTCTCTG
p60R6 TCTAGAGAAGAACTTTTAAATCTGC
p60R7 TCTAGAAAATCTGCTTTTTCTTGAC
p60R5b AAGCTTCTTTTCCATTAACTATTTTG
p60F11 TCTAGACGTGTGGAGATCAACAT
p60R3 TCTAGACTTTTCCATTAACTATTTTG
35SXba TCTAGACAAGACCCTTCCTC
35SBam GGATCCTCCTCTCCAAATGA
mp60DOF1F1 AGTTAATGGcgcgaGCAGAGTGACTCGTGA
mp60DOF2F1 TGGCAGATCCcgcgaAGGTTGTCAAGAAAA
mp60DOF3F2 TGTCAAGAcgcgaCAGATTTAAAAGTTCTT
mp60DOF4F2 CAAGAAAAAGCAGATTTcgcgaTTCTTC
mp60WRKYF1 AAGCTTCGTGTGGAGATCAACATATCTTCGTTAATTGAaTACGCAAAATA
GUSRTF1 TACGGCAAAGTGTGGGTCAATAATCA
GUSRTR1 CAGGTGTTCGGCGTGGTGTAGAG
ATACT2F TGCTTCTCCATTTGTTTGTTTC
ATACT2R GGCATCAATTCGATCACTCA
qRT-MYB60-F CATGAAGATGGTGATCATGAGG
qRT-MYB60-R TTCCATTTGACCCCCAGTAG
PP2a-F CAGCAACGAATTGTGTTTGG
PP2a-R AAATACGCCCAACGAACAAA
  1. Italic and lower case letters indicate restriction and mutagenised sites, respectively