Skip to main content

Table 5 Primers used for gene expression analysis.

From: Genetic variation of γ-tocopherol methyltransferase gene contributes to elevated α-tocopherol content in soybean seeds

Primer name Direction Nucleotide sequence (5' to 3')
γ-TMT1 Forward CTGGAGGCAGAGTATAGCG
  Reverse AAACTCCCAGGTCCCACCCAAT
γ-TMT2 Forward GAAGCAAGTTTCCAACAGGTCG
  Reverse CGCCAATCATAGGAGATATTGCATATG
γ-TMT3 Forward CAGTGGACTTAAAACCATAAAGGGAGC
  Reverse CCACATACTCTATATCATTCACACGAG
18S rRNA Forward TGATTAACAGGGACAGTCGG
  Reverse ACGGTATCTGATCGTCTTCG
β-tubulin Forward GAGAAGAGTATCCGGATAGG
  Reverse GAGCTTGAGTGTTCGGAAAC