Skip to main content

Table 1 Minisatellites and satellites identified in the c0 t-1 library of B. vulgaris

From: Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris

tandem repeat size [bp] c0 t-1hits G/C-content [%] identity [%] EMBL accession representative monomere sequence
BvMSat01 10 7 34 40 - 100 ED023089 AACTTATTGG
BvMSat11 15 1 41 36 - 100 DX580797 TAAATAGTCAAGCCC
BvMSat05 21 5 29 38 - 100 ED029002 ACTGAAAAAAAATGAAGACTA
BvMSat07 30 4 32 90 - 100 ED019743 GAAAAAATAAGTTCAGATCAGATCAGATCA
BvMSat08 32 1 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT
BvMSat09 32-39 5 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA
BvMSat03 40 3 33 55 - 100 ED024452 GTCTCTAAAGCCATGTATTTAGCGTCACATGAATTTAGTT
BvMSat10 51 3 24 78 - 100 DX980914 GTTTGTTCTTAAAAGGTTGTTCTTGAATTATTATTCAAGTGTTTGGAAAGA
BvMSat04 96 2 41 70 - 100 DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAA
       GGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTG
FokI-satellite 130 1 60 81 - 100 DX979624 GGGACTTAGGAGAGTGACCCAACCAAGGAGGGAGACCTCCTTGGGCTGAGT
       TGGGTGGACGCGGCTCGGATGAGGGGCCAATGAGCCCCACGCTTGTCCGAG
       CCGGTGCCGTCTCTCGCCATGTCAATCT
AluI-satellite 173 1 33 78 - 100 ED022281 ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCT
       AAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGT
       TTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGT
       TTTTTGGGTTTCATGTTCCT
HinfI-satellite 325 2 45 75 - 86 DX982322 TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA
       AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT
       CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT
       TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC
       GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT
       TGGGGAATTTTTGGACTACTTCTTCAGGCCCGGTCATATTTTTCTTTCGAA
       ACATTCCTAGGAGTGCCGA
  1. The tandem repeats are listed according to their monomer size.