Skip to main content

Advertisement

Table 3 Primer sequences for realtime PCR

From: Large impact of the apoplast on somatic embryogenesis in Cyclamen persicum offers possibilities for improved developmental control in vitro

Name Gene product Forward primer (5'-3') Reverse primer (5'-3')
CYC32T7_B02 Ef-Tu CGCCATACTGCCTTTTTCTC CTCCCGGCATAACCATCTTA
CYC01T7_E12 GST1 CATCCTGGGAGAACAATGTG ACCCCCAAAGTAGGGTTTGT
CYC32T7_B11 GST2 GCTCGGGATTTTGCTAGAAG TTCCCTGATGACAGAGCAAT
CYC04T7_G06 putative receptor kinase CGTGGTGAGAGAAGAATGGA GCATTTTAGGCCTCTTTTCG
CYC04T7_G04 POX AAATCTCCAGCAAGGCAAAG GCCGTGATAAAGGGACTGGTT
CP_59_C1 XET TTCCGTGCAGGCTAAGTTCT AGCGGAGCCTTCTGTATTGA