Skip to main content

Table 2 Primers used for expression analysis and mapping.

From: Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG) genes during seed development and in response to external ABA

Gene Primer Sequence (5'-3') Tm (°C) Fragment (bp)
  Expression    
HvFIE HvFIE F1 GTGCCCGATTGTGACATTTGGTTT 70 264
  HvFIE R1 CACGGCGGTTTTTGCTTCCTTC 68  
HvE(Z) HvE(Z) F1 AAGCATCTGGTTCTCATCGTC 62 293
  HvE(Z) R1 TGGTCCACCTCAACAAGTAGA 62  
HvSu(z)12a HvSu(z)12a F1 TCGTGACTCGGTAGGAAACATTG 68 261
  HvSu(z)12a R1 CCAATGTTAATAGGTGTTTCAAG 62  
HvSu(z)12b HvSu(z)12b F1 GTATATGAGTTGAGCATAGTGC 62 278
  HvSu(z)12b R1 TTCAGATGGATTTCATTACAGC 60  
HvSu(z)12c HvSu(z)12c F ATGTGCCGTCAACCGTCCACG 68 463
  HvSu(z)12c R CTCCAGCTTGCCCTTGTGAAG 66  
HvActin Barley Actin F ATGGCTGACGGTGAGGACATCCAGCC 72 1111
  Barley Actin R TCAGAAGCACTTCCTGTGGACGATCGC 71  
  HvActin F GCCGTGCTTTCCCTCTATG 60 235
  HvActin R GCTTCTCCTTGATGTCCCTTA 62  
HVA22 HVA22 F TGGCGCTCCCGCAGTTCAAG 64 123
  HVA22R CCTTGAGTATGTGCACCTTGTG 62  
  Mapping    
HvFIE HvFIE F2 GTGGGAGCCAAAAACAAAAG 60 262
  HvFIE R2 GGCGTCACAGGCTAAGTAAGG 61  
HvE(Z) HvE(Z) F2 AAATCAGATGTTGCAGGATGG 60 550
  HvE(Z) R2 GCTCCCTTGCATAGATACCAAC 61  
HvSu(z)12a HvSu(z)12a F2 ACTCGTGCAGAACCCAAGAC 60 576
  HvSu(z)12a R2 ACCCATCCCAGCTACAACAG 60  
HvSu(z)12b HvSu(z)12b F2 ATATTCCTTGGGCCTGTGAG 59 308
  HvSu(z)12b R2 TGGAACAGAACACGACGAAG 54