Skip to main content

Table 1 Distinct sugarcane pri-miRNAs identified in this study

From: Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane

miRNA Sequence source Sequence ID Sugarcane MIRgene miRNA Mature Sequence Location NM (nt) LP (nt) MFEI Conserved in rice
miR156a EST TC110664 SsMIR156b/c UGACAGAAGAGAGUGAGCAC 5' 0(0) 411 0.81 Yes
miR159a EST TC79108 SsMIR159 UUUGGAUUGAAGGGAGCUCUG 3' 0(0) 265 0.78 Yes
miR167a EST TC105794 SsMIR167 UGAAGCUGCCAGCAUGAUCUG 5' 0(0) 193 0.93 Yes
miR168a EST TC97302 SsMIR168 UCGCUUGGUGCAGAUCGGGAC 5' 0(0) 104 0.86 Yes
miR169 EST TC105581 SsMIR169 UAGCCAAGGAUGACUUGCCGG 5' 0(1) 148 0.92 Yes
miR396a EST CA240723 SsMIR396 UUCCACAGCUUUCUUGAACUG 5' 0(0) 134 1.02 Yes
miR827 EST CA215078 SsMIR827 UUAGAUGACCAUCAGCAAACA 3' 0(1) 140 1.01 Yes
miR408a EST TC108481 SsMIR408a CUGCACUGCCUCUUCCCUGGC 3' 0(1) 215 0.67 Yes
  EST TC74315 SsMIR408b CUGCACUGCCUCUUCCCUGGC 3' 0(1) 283 0.80 Yes
miR437 EST CA185316c SsMIR437a AAAGUUAGAGAAGUUUGACUU 3' 0 195 1.36 Yes
  EST CA191146c SsMIR437b AAAGUUAGACAAGUUUGACAU 3' 2 233 0.92 Yes
  EST CA300436c SsMIR437c AAAGUUAGAGAAGUCUGACUU 3' 1 197 1.36 Yes
miR444 EST CA186150 SsMIR444a UGCAGUUGUUGCCUCAAGCUU 3' 0 105 1.31 Yes
  EST CA105916 SsMIR444b UGCAGUUGUUGCCUCAAGCUU/UUGUGGCUUUCUUGCAAGUUG 3' 0 132 1.24 Yes
  EST TC110432 SsMIR444c UGCAGUUGUUGUCUCAAGCUU/UGUUGUCUCAAGCUUGCUGCC 3' 0 152 1.20 Yes
miR528 EST CA290495 SsMIR528 UGGAAGGGGCAUGCAGAGGAG 5' 0 94 0.86 Yes
miR1128 EST CA222833c SsMIR1128 UACUACUCCCUCCGUCCCAAA 5' 1 275 1.17 No
miR1432 BAC FJ348731 SsMIR1432 CUCAGGAAAGAUGACACCGAC 5' 1 118 1.15 Yes
miR319b EST TC87836 SsMIR319 UUGGACUGAAGGGUGCUCCC 3' 0(0) n.d. n.d. Yes
  1. aSugarcane miRNA families deposited in the miRbase v. 14.
  2. bPri-miRNA identified only by precursor sequence homology. Therefore, we could assign neither LP nor MFEI values to this precursor.
  3. NM, nucleotide mismatches with rice, sorghum and Arabidopsis (in parentheses), when applicable.
  4. LP, length of the pre-miRNA.
  5. MFEI, minimal free energy index.
  6. CSugarcane pri-miRNAs with similarity (evalue <e-10) to MITE-derived hairpin sequences. miR437 precursors have similarity with Oryza sativa MITE-adh type A (2.5e-17) while miR1128 precursor is similar to O. glumipatula pangrangja MITE element (1.2e-11).