Skip to main content

Table 5 List of primers for the seven proposed DNA barcoding markers.

From: DNA barcoding of the Lemnaceae, a family of aquatic monocots

Marker Primer sequence Amplicon size (Lemna minor) Ta Optimum (Lemna minor)
psbK-psbI Forward: 5'-TTAGCATTTGTTTGGCAAG-3'; 544 bp 51°C
  Reverse: 5'- AAAGTTTGAGAGTAAGCAT -3'   
trnH-psbA Forward: 5'-GTTATGCACGAACGTAATGCTC-3'; 300 bp 55°C
  Reverse: 5'- CGCGCGTGGTGGATTCACAATCC-3'   
matK Forward: 5'-CGTACTGTACTTTTATGTTTACGAG-3'; 862 bp 55°C
  Reverse: 5'- ATCCGGTCCATCTAGAAATATTGGTTC -3'   
atpF-atpH Forward: 5'-ACTCGCACACACTCCCTTTCC-3'; 675 bp 53°C
  Reverse: 5'- GCTTTTATGGAAGCTTTAACAAT -3'   
rpoB Forward: 5'-ATGCAGCGTCAAGCAGTTCC-3'; 406 bp 55°C
  Reverse: 5'- TCGGATGTGAAAAGAAGTATA -3'   
rpoC1 Forward: 5'-GGAAAAGAGGGAAGATTCCG-3'; 509 bp 56°C
  Reverse: 5'- CAATTAGCATATCTTGAGTTGG -3'   
rbcL Forward: 5'-GTAAAATCAAGTCCACCACG-3'; 580 bp 56°C
  Reverse: 5'-ATGTCACCACAAACAGAGACTAAAGC -3'