Skip to main content

Archived Comments for: Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait

Back to article

  1. CORRECTION

    K Bilyeu, USDA/ARS Plant Genetics Research Unit

    7 September 2011

    BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195
    Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait

    CORRECTION:
    In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed:
    Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).

    The correct sentence should read:
    Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final concentration).

    Kristin Bilyeu
    31 August 2011

    Competing interests

    No competing interests.

Advertisement