Skip to main content

Table 2 De novo insertion sites of Dart-related TEs identified by transposons-display (TD) (designated as Dart-TDI) in the rice-Zizania introgressants

From: Transpositional reactivation of the Dart transposon family in rice lines derived from introgressive hybridization with Zizania latifolia

Insertion sites Position of insertion sites Locus-specific primers (5'-3') Inserted into TIR (5'-3') TSD (5'-3')
Dart-TDI-1 Chr.3; position: 2726981;
non-coding
For: tcacgcagtagatgccaaag
Rev: gcacgtctccgtagctctct
RZ2 gcccatttggccacctcta tgctagta
Dart-TDI-3 Chr.10; position:4241777;
OSJNAb0015J03.2 exon
For: gtagagggctcaatcgtgga
Rev: ctaaggtctcgaggcacacc
RZ1,
RZ2
gcccatttggccacctcta gcatgaag
Dart-TDI-4 Chr.5; position: 29238540;
non-coding
For: gcccgtttggccacctctat
Rev: tgtaaaatgaccagcgacga
RZ1,
RZ2, RZ35
gcccatttggccacctcta tgtggttg
Dart-TDI-5 Chr.5; position:14917879;
non-coding
For: tacggttcccattgttttcc
Rev: gggtgtgcacgatgttgtaa
RZ2 gcccatttggccacctcta tacaatgt
Dart-TDI-7 Chr.12; position:12726861;
non-coding
For: ttgttgttagttttgcgtgtaga
Rev: gaaagcaggttggagaggtta
RZ1,
RZ2
gcccatttggccacctcta cgctagta
Dart-TDI-8 Chr.3; position:27833204;
Os03g0699200 exon
For: taattaagttggaagtgggaca
Rev: tttctgtaagattacaaccagaggt
RZ1,
RZ2, RZ35
gcccatttggccacctcta tggagtat
Dart-TDI-10 Chr.3; position:17730615;
non-coding
For: ctttcgtaggcgaaaagtgc
Rev: ctgcaaccacctgtctctga
RZ2 gcccatttggccacctcta cgaagaac
Dart-TDI-11 Chr.4; position:638561;
non-coding
For: catgaattgggtgccatgta
Rev: ccccatagggtaggcaaaat
RZ1,
RZ2, RZ35
gcccatttggccacctcta tctgaatt
Dart-TDI-16 Chr.5; position:10010289;
non-coding
For: gcccgtttggccacctctat
Rev: ggtggaggacctgctcaata
RZ1,
RZ2
gcccatttggccacctcta ttcgacat
Dart-TDI-18 Chr.12; position:6156546;
non-coding
For: tgagcacgcctagctcagta
Rev: atgcacggcaactttctctt
RZ1,
RZ2
gcccatttggccacctcta cctctcaa
Dart-TDI-19 Chr.12; position:6345593;
non-coding
For: gcccgtttggccacctctac
Rev: acaaatggcctcctgtgttc
RZ1 gcccatttggccacctcta caagcagc
Dart-TDI-20 Chr.12; position:21951729;
non-coding
For: tccagccaaaccctgttc
Rev: gctcgccagatgtcaggt
RZ1 gcccatttggccacctcta cgtcggga
Dart-TDI-21 Chr.1; position:19308190;
non-coding
For: tgctacagtagaagggcgtgta
Rev: atgcacatctggtcttttgatg
RZ2 gcccatttggccacctcta cacacgta
Dart-TDI-22 Chr.2; position:6211564;
non-coding
For: ggatccgtttggatcagaga
Rev: tgcagcagctgattcatacc
RZ2 gcccatttggccacctcta ccaatatt
Dart-TDI-24 Chr.5; position:10749306;
OSJNBa0037H03.12 intro
For: gagctgctcctgaaaaccac
Rev: gaattttccttgccgtgtgt
RZ1,
RZ2
gcccatttggccacctcta tcatgttt
Dart-TDI-25 Chr.1; position:25299;
non-coding
For: gtgccggagaatgatttgat
Rev: atttccctcgatgcactgtc
RZ1,
RZ2
gcccatttggccacctcta tacgcagc
Dart-TDI-26 Chr.2; position:10207338;
Os02g0277600 intro
For: gcccatttggccacctcta
Rev: cgaatgagtgtccttgatcg
RZ1,
RZ2
gcccatttggccacctcta agcaaaac
Dart-TDI-27 Chr.12; position:23594158;
Os12g0572000 3'UTR
For: gcccgtttggccacctctac
Rev: agcaacccacagaacagctt
RZ35 gcccatttggccacctcta ccaccctc
Dart-TDI-28 Chr.8; position:23713525;
non-coding
For: gcccgtttggccacctctac
Rev: tctgcggttgaaacaatgag
RZ2 gcccatttggccacctcta cggctaac
Dart-TDI-29 Chr.7; position:20028374;
non-coding
For: gcccgtttggccacctctat
Rev: aaagtcaatggaaaggggaaa
RZ1,
RZ2
gcccatttggccacctcta tcaaaatc
Dart-TDI-30 Chr.4; position:25704503;
Os04g0514800 exon
For: gcccatttggccacctcta
Rev: ggcaatgcggttggtttc
RZ1,
RZ2
gcccatttggccacctcta cgctattc