Skip to main content

Table 2 Primers used in this experiment

From: Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

Primer sequence
INT1 GGTGCTTCAACTCTAAGG
INT2 CAAATAGTGCTTCAACCTC
GSP1 CAGATTTGCATCATTCCATTGAGAAGAC
GSP2 GTCTGTGATGCAAGAATTACTG
GSP3 GTCTCCTAACCTTAGAGTTGAAGCAC
GSP4 TTCTACCCCTCCTCCCATAAAC
GSP5 CCACGGAAAAGAACCTCCACATAAG
GSP6 CGGTGATGATGGAAAAAGACTC
GSP7 CATCAGCTCTAATTTAGTAACTGATCTCATT
GSP8 CTTAACCAATGTTCAAAGGATACTAATTAGCATTC
GSP9 TCCTTTAGTTATAGCTCAATAACAATGAAG
GSP0 GTGCTTCAACCTCGCTGACAG
AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
AUAP GGCCACGCGTCGACTAGTAC
S1 AAATGGATTTAATTGGTATAAATTATTAGTGT
S2 GGAGAATGCTAATTAGTATCCTTTGAACAT
S3 CTTTACTTTCAGTTCAGGAACTTTCTG
HS1 CTAAGCTTAAATGGATTTAATTGGTATAAATTATTAGTGT
HS2 CTAAGCTGGAGAATGCTAATTAGTATCCTTTGAACAT
HS3 CTAAGCTTCTTTACTTTCAGTTCAGGAACTTTCTG
RS ATGGAGGAAATCCAGGCAAAG
Bin1 CCAGTTGAAAAAGTAAAGAACTTTGTCC
Bin2 GGTTGAGCTGAGAGAGTAGAACTG
Ins CTAAGCTTTACTTTTTCAACTGGGTGAGTCTT
Inr CTAAGCTTTGCTCAGGCTTCACCACTTC