Skip to main content

Table 4 Polymorphism character and position in reference sequence.

From: Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.)

Gene Position Polymorphism Position in reference sequence
PAL 947 Intron SNP TTTAGAGACGATCGCAATCCA(C/T)
  1652,1655 Intron SNP CCTTGTGCGCTGGCTCCC(T/C)TT(C/T)
4CL2 192 synonymous SNP TACTGCTTCGGGAAGATGGG(T/C)
  217 Val to Ile SNP TGGCGGAGCGGGCGTGCCTG(G/A)
COMT 2358 3'UTR indel CGCCGTCGTCGTCTTCTTCT(+/-)
F5H 65 Leu to Pro SNP ACGCGCGACAATATCAAGGC(T/C)
4CL1 454 Exon indel TTCGTCGGCAAGGTGCGGGGG(+/-)
  810s Exon indel GCTGTGCGGGATGCGCGCCGG(+/-)
CCoAOMT2 75 Exon Indel CAGGCCAACGGCAACGGCAA(+/-)
  144 synonymous SNP CTGCTCAAGAGCGACGACCT(C/G)
  406 Intron SNP ACCGAGATCTGAGAACGAAC(A/G)
  663 Intron indel CCTAGGATCTTAACCACCCC(+/-)
  1. Polymorphism character and position in reference sequence. (N/N): SNP substitution; (+/-): indel; s: singleton; M73235, AY323238, AY279014, AX204867, AX204868, and AX204869 were used as reference sequences for COMT, CCoAOMT1, CCoAOMT2, 4CL1, 4CL2, and F5H respectively. The reference sequences for PAL are the conserved sequences before each polymorphism in our alignment.