Garlic stalk waste and arbuscular mycorrhizae mitigate challenges in continuously monocropping eggplant obstacles by modulating physiochemical properties and fungal community structure

Abstract

Background and aims

Continuous vegetable production under plastic tunnels faces challenges like soil degradation, increased soil-borne pathogens, and diminished eggplant yield. These factors collectively threaten the long-term sustainability of food security by diminishing the productivity and resilience of agricultural soils. This research examined the use of raw garlic stalk (RGS) waste and arbuscular mycorrhizal fungi (AMF) as a sustainable solution for these issues in eggplant monoculture. We hypothesized that the combined application of RGS waste and AMF would improve soil physicochemical properties compared to untreated soil in eggplant monoculture. The combined use of RGS and AMF was expected to suppress soil-borne pathogens, increase the abundance of soil beneficial microorganisms and alter fungal community structure. The combined application of RGS and AMF will significantly enhance eggplant yield compared to untreated plots. This study aimed to determine whether AMF and RGS, individually or in combination, can ameliorate the adverse effects of monoculture on eggplant soil. We also investigated whether these treatments could enhance eggplant yield.

Methods

The experiment was arranged in a completely randomized design with four treatments: AMF, RGS, and a combined treatment of AMF + RGS (ARGS), along with a control. Each treatment was replicated three times, Eggplant seedlings inoculated with AMF and treated with RGS amendments, both individually and combined. The effects on root traits, soil physicochemical properties, soil enzyme activity, and fungal community structure were investigated.

Results

RGS amendments and AMF inoculation improved root length, volume, and mycorrhizal colonization. The combined treatment showed the most significant improvement. RGS and AMF application increased soil nutrient availability (N, P, K) and organic matter content. Enzyme activities also increased with RGS and AMF treatments, with the combined application showing the highest activity. Soil electrical conductivity (EC) increased, while soil pH decreased with RGS and AMF amendments. Sequencing revealed a shift in the fungal community structure. Ascomycota abundance decreased, while Basidiomycota abundance increased with RGS and AMF application. The combined treatment reduced the abundance of pathogenic genera (Fusarium) and enriched beneficial taxa (Chaetomium, Coprinellus, Aspergillus). Pearson correlations supported the hypothesis that soil physicochemical properties influence fungal community composition.

Conclusions

This study demonstrates the potential of co-applying RGS and AMF in continuous cropping systems. It enhances soil physicochemical properties, reduces soil-borne pathogens, and promotes beneficial microbial communities and eggplant yield. This combined approach offers a sustainable strategy to address the challenges associated with eggplant monoculture under plastic tunnels.

Background

The global population is rapidly increasing and is projected to reach 9 billion by 2050 [1]. This growth exerts significant pressure on natural resources, driving an increased demand for food, fiber, and energy. Despite the heavy exploitation of existing farmland, the available agricultural land is expected to decrease, further straining efforts to feed the growing population.

Repeated cultivation of the same crop is grown repeatedly on the same land, known as continuous monocropping (CMC), can lead to mismanagement of land resources. This practice often results in soil deterioration and high usage of mineral fertilizers [2].

CMC has been widely implemented across various regions, particularly in China, where by the end of 2013, nearly 95% of the 1.3 Mha of arable land was subjected to CMC [3]. Eggplant (Solanum melongena L.) is one of the most economically significant cash crops globally. China primarily produces eggplant under plastic sheds, and CMC is a widespread practice. Despite its efficiency, CMC has raised concerns about the long-term sustainability of both the environment and soil quality [4, 5].

The heavy use of synthetic fertilizers, especially nitrogen fertilizers in CMC, can lead to reduced efficacy of plant nutrient uptake, depletion of nutrients in the soil, secondary soil salinization and acidification, secondary salinization, and soil acidification. These factors contribute to significant shifts in the soil microbiome and the development of replanting issues, commonly known as soil sickness or CMC obstacles [6, 7]. When eggplant is continuously grown under plastic sheds, these CMC-related problems intensify, causing a significant decline in long-term productivity. To mitigate these challenges and promote environmental health, alternative strategies that improve soil quality and sustainability are urgently needed.

Soil microorganisms play critical roles in maintaining soil health and supporting plant growth. They are essential for soil structure formation, nutrient cycling, and enhancing plant resistance to diseases and pests [8]. The rhizosphere, a narrow region of soil influenced by plant roots, hosts a more diverse microbial community than bulk soil. The composition and function of these microbial communities are closely linked to land management practices, such as chemical fertilization and irrigation, which can significantly influence their ecological value [9]. Extensive research has shown that environmental and ecological factors significantly impact the diversity and composition of soil microbial communities. These communities are influenced by both beneficial microorganisms and harmful soil-borne pathogens [10]. Numerous studies have also revealed that CMC disrupts soil microbial communities, leading to reduced crop yields [7, 11].

Agrochemicals, while intended to boost agricultural productivity, often contribute to soil degradation and the emergence of soil sickness in several ways. First, they can disrupt soil structure by causing compaction, which reduces air and water movement. Second, the overuse of fertilizers can lead to nutrient imbalances, harming the natural nutrient cycling processes supported by microorganisms. Third, many pesticides are toxic to beneficial soil organisms, further disrupting microbial communities [12, 13]. This loss of microbial diversity can lead to soil sickness, characterized by poor plant growth and increased disease susceptibility. CMC exacerbates these issues, as it further depletes soil health and reduces crop yields [7].

AMF plays a crucial role in nutrient cycling and can effectively mitigate the negative impacts of CMC on soil health and crop productivity. By forming a symbiotic relationship with plant roots, AMF enhances the uptake of essential nutrients, particularly phosphorus and nitrogen [14]. This process is facilitated by the growth of a hyphal network that extends beyond the root zone, allowing the fungi to access nutrients that are otherwise unavailable to the plant. Increased availability of phosphorus and other nutrients is particularly beneficial in CMC systems, where nutrient depletion creates adverse soil conditions [14, 15].

Additionally, AMF forms synergistic relationships with other soil organisms, promoting microbial populations and diversity. This collaboration accelerates the decomposition of organic matter, facilitating the rapid release of nutrients essential for plant growth [16]. Furthermore, AMF contributes to soil aggregation, which improves soil structure and enhances water retention, therby helping to sustain plant roots during challenging conditions. Collectively, these benefits help reduce the adverse effects associated with CMC, such as nutrient depletion and decreased crop yields. Therefore, integrating AMF into agricultural practices can enhance nutrient availability and increase the productivity of monocropping systems [17].

Both AMF and RGS waste play vital roles in promoting sustainable agricultural practices by improving soil health and increasing nutrient availability. AMF facilitates nutrient uptake, particularly phosphorus and nitrogen, through its extensive hyphal networks that extend beyond the root zone, accessing nutrients that are otherwise unavailable to plants [14]. In parallel, RGS serves as a beneficial organic amendment that enriches soil quality [18]. The recovery and recycling of agricultural waste have become critical issues within sustainability discussions, and the use of garlic waste as an organic amendment has emerged as a promising solution due to its balanced nutritional profile [19]. Recent advancements in garlic waste management have identified its potential as a source of biofertilizers and soil conditioners, which can mitigate the adverse environmental impacts associated with conventional chemical fertilizers. This innovative approach not only addresses waste management challenges but also enhances soil quality and promotes crop productivity. Research indicates that the application of garlic stalks can lower soil pH, thereby improving electrical conductivity and nutrient availability [18]. The processes involved in the addition of garlic substrates to the soil are closely linked to solubilization mechanisms, where soil phosphatase activity and organic matter turnover increase phosphorus availability. In addition, the decomposition of garlic stalks and their associated activities significantly influence soil pH and electrical conductivity, which are critical for nutrient dynamics [18]. It is crucial to highlight the combined impact of AMF and RGS amendments, which have been demonstrated to significantly enhance soil health by improving nutrient cycling, stimulating microbial activity and plant development. The implementation of this integrated strategy not only mitigates the adverse effects associated with CMC but also enhances the long-term sustainability of agricultural ecosystems by fostering improved soil composition and resilience to environmental challenges.

Although few studies have examined the effects of applying RGS or AMF on plants and soil, comprehensive studies on the combined application of RGS and AMF and their impact on soil fungal community structure remain limited. CMC characterized by the cultivation of the same crop in the same soil, presents significant agronomic challenges, including nutrient depletion, reduced microbial diversity, and the accumulation of soil-borne pathogens. This study hypothesizes that applying RGS, either alone or in combination with AMF, enhances soil physicochemical properties and alters the soil fungal community by promoting beneficial microbes, suppressing soil pathogenic microbes, and increasing eggplant yield. We also hypothesize that these changes will mitigate the challenges of CMC and support sustainable eggplant production.

The main objectives of this study were to: (1) assess the impact of AMF and RGS, individually or in combination, on soil properties and fungal communities, (2) evaluate whether alterations in soil properties affect fungal community structure, and (3) investigate whether these changes in soil properties and fungal communities can address issues related to continuous cropping practices.

Results

Effect of AMF inoculation and RGS amendment on root traits and soil chemical properties

Applying RGS and AMF, either alone or in combination, significantly enhanced root traits, including root length, surface area, volume, and colonization percentage, with the most pronounced improvements observed when both were applied together. The highest increment in root length, root surface area, root volume, and root colonization percentage was observed when both AMF and RGS were applied synergistically, resulting in increases of 5.10%, 20.10%, 63.86%, and 52.00% compared to the control group (Fig. 1A and D).

Fig. 1

Effect of RGS and AMF on root length (A), root surface area (B), root volume (C), and root colonization (%). The data presented in this study are expressed as a means of ± SE (n = 5). Different letters on the bar indicate statistically significant differences (p < 0.05); Tukey post-hoc test between treatments

The addition of RGS and AMF significantly increased the availability of key nutrients, including nitrogen (N), phosphorus (P), and potassium (K), compared to monocropped soil. The combined treatment (ARGS) led to the highest increases in available nitrogen (AN) and potassium (AK), with improvements of 71.02% and 20.25%, respectively, over the control. RGS alone resulted in increases of 60.25% and 17.00%, while AMF alone showed enhancements of 51.40% for AN and 14.17% for AK. In terms of available phosphorus (AP), the ARGS treatment also produced the greatest increase, at 69.05%, followed by AMF at 54.66% and RGS at 49.58%, compared to the control (Table 1).

The application of RGS, AMF, and their combination (ARGS), significantly influence soil chemical properties (Table 1). Applying RGS, AMF, and ARGS increased soil EC by 40%, 38.82%, and 44.17%, respectively. However, the treatments showed an opposite trend in soil pH. Compared to the control (monocropping soil), RGS reduced pH by 1.15%, AMF by 1.67%, and ARGS by 2.18%. RGS application notably increased soil organic carbon (OC) and organic matter (OM), while AMF was less effective. The highest increases in OC and OM were observed with ARGS (33.19% and 33.21%), followed by RGS (23.51% and 23.47%) and AMF (11.95% and 11.90%), respectively, compared to the control.

Compared to the control, soil amendments with RGS, AMF, or their combination (ARGS) significantly boosted enzymatic activities, including invertase, urease, β-glucosidase, and phosphatase (Table 1). The ARGS treatment showed the most significant increases, with invertase, urease, β-glucosidase, and phosphatase activities rising by 78.05%, 81.50%, 53.66%, and 59.26%, respectively. The application of RGS alone enhanced these enzyme activities by 41.11%, 66.76%, 50.22%, and 21.74%, respectively, while AMF application resulted in increases of 36.9%, 20.01%, 46.13%, and 38.65%, respectively, compared to the control.

Moreover, the amendments significantly increased microbial biomass carbon (MBC) and microbial biomass nitrogen (MBN) levels (Table 1). The ARGS treatment produced the highest MBC and MBN values (473.66 mg/kg and 28.29 mg/kg), while the control (CK) had the lowest (186.52 mg/kg and 17.36 mg/kg). Increases in MBC and MBN were 90.12% and 36.23% for ARGS, 84.82% and 15.32% for RGS, and 153.95% and 62.96% for AMF, all compared to the control.

Table 1 The influence of different treatments on soil physiochemical properties of continuous mono-cropping eggplant soil

Impact of AMF inoculation and RGS amendment on fungal alpha diversity

Molecular analysis of the soil microbiome across all treatments produced a total of 42,890 reads from the ITS1F and ITS2R regions of the fungal genome. These reads were categorized into 701 OTUs, representing 8 phyla, 20 classes, 47 orders, and 93 families. Further classification identified 168 genera and 262 species within these families.

The fungal richness indices, Ace and Chao, were lower in all amended treatments compared to the untreated control, but these reductions were not statistically significant (Table S2). A similar pattern was observed for the Shannon diversity index. In contrast, the application of RGS, AMF, or their combination (ARGS) significantly increased the Simpson index compared to the control soil (Table S2).

A Venn diagram displayed the distribution of common and unique fungal OTUs across different treatments (Fig. 2). Across all treatments, 701 fungal OTUs were shared. Among these, the CK-AMF treatment had 69 (9.84%) common OTUs, followed by CK-RGS with 26 (3.71%). The fewest common OTUs, 8 (1.14%), were observed between AMF and ARGS treatments. CK had the highest number of unique OTUs (112), followed by AMF (46), ARGS (18), and RGS (16).

Fig. 2

Unique and shared fungal operational taxonomic units (OTUs) distribution in different treatments. CK: control without raw garlic stalk and arbuscular mycorrhizal fungi, RGS: raw garlic stalk without arbuscular mycorrhizal fungi, AMF: arbuscular mycorrhizal fungi without raw garlic stalk, ARGS: a combination of arbuscular mycorrhizal fungi and raw garlic stalk

Alterations in fungal community structure (beta diversity) following AMF inoculation and RGS amendment

Principal coordinates analysis (PCoA) based on UniFrac distance was conducted on fungal OTUs. The differences in fungal community composition across treatments were moderate. The different treatments explained a significant portion of the variation in fungal community structure (58.22%). The first two principal components accounted for 43.38% and 14.84% of the variation, respectively (Fig. 3). Notable differences were observed between monocropping samples and other treatments, particularly in those amended with RGS.

Fig. 3

UniFrac weighted principal coordinates analysis showing fungal composition variation among replications of different treatments. CK: control without raw garlic stalk and arbuscular mycorrhizal fungi, RGS: raw garlic stalk without arbuscular mycorrhizal fungi, AMF: arbuscular mycorrhizal fungi without raw garlic stalk, ARGS: a combination of arbuscular mycorrhizal fungi and raw garlic stalk

Impact of AMF inoculation and RGS amendment on the taxonomic composition of fungal communities

The composition and distribution of fungal taxonomic groups varied widely across all treatments. The relative abundance of fungal taxa in each treatment is depicted in Fig. 4a and b. Soil amendments with RGS, AMF, or their combination (ARGS) substantially impacted the abundance and presence of different fungal genera. Among the 28 identified genera, 17 showed an average relative abundance of more than 1% across treatments. Chaetomium was the most dominant genus, representing 42% of all treatments, followed by Aspergillus (5.14%), Sordariomycetes_unclassified (4.37%), and Fusarium (4.33%).

Amendments with RGS, AMF, or both led to noticeable changes in the composition of fungal genera. RGS application notably increased the relative abundance of Chaetomium, Coprinellus, Aspergillus, Arthrographis, Microascus, Ascobolaceae_unidentified, and Stachybotrys compared to the control (CK). Additionally, RGS suppressed the growth of 17 out of the 28 genera found in CK. In AMF-amended soil, the relative abundance of Entoloma, Microascaceae_unclassified, Ascomycota_unclassified, Acremonium, Chaetomiaceae_unclassified, and Cladosporium increased, while 11 other fungal genera were inhibited.

When RGS and AMF were applied together, their combined effect further boosted the abundance of Glomerellaceae_unclassified, Chaetomiaceae_unclassified, Chrysosporium, Nectriaceae_unclassified, Arthrographis, and Microascus. However, compared to CK, the rest of the fungal genera were less represented in the soils treated with RGS and AMF.

Fig. 4

Relative abundance of different fungal phylum (a) and genera (b) in all treatments. CK: control without raw garlic stalk and arbuscular mycorrhizal fungi, RGS: raw garlic stalk without arbuscular mycorrhizal fungi, AMF: arbuscular mycorrhizal fungi without raw garlic stalk, ARGS: a combination of arbuscular mycorrhizal fungi and raw garlic stalk

Comparative assessment of fungal biomarkers

To further investigate changes in fungal community structure across different soil amendments and control groups (Fig. 5), LEfSe and LDA analyses were performed. A threshold LDA score of 2 or higher was used to distinguish fungal groups among the treatments (Fig. 5). Cladograms were also used to illustrate the fungal taxa distribution across treatments (Fig. 6). The control (CK) had the highest number of dominant fungal groups, including Hypocreales, Nectriaceae, Mortierellaceae, Zygomycota, Zygomycota_c_Incertae_sedis, Mortierellales, and several unclassified fungal groups at different taxonomic levels (Fungi_c_unclassified, Fungi_f_unclassified, Fungi_p_unclassified, and Fungi_o_unclassified), as well as Leotiomycetes_o_Incertae_sedis, Leotiomycetes, Sporidiobolales_f_Incertae_sedis, Sporidiobolales, and Microbotryomycetes.

The fungal taxa such as Psathyrellaceae, Eremomycetaceae, and Dothideomycetes_o_Incertae_sedis were effective in distinguishing RGS from the other treatments. Similarly, AMF-treated soil showed a significant presence of Hypocreales_f_Incertae_sedis, Capnodiales, Davidiellaceae, Plectosphaerellaceae, and Sordariomycetes_o_Incertae_sedis in soils treated with both RGS and AMF (ARGS), the fungal community was dominated by members of Eurotiomycetes, Trichocomaceae, Eurotiales, Onygenaceae, Onygenales, and Pluteaceae, indicating a higher diversity of fungal isolates.

Fig. 5

The least discriminant scores (LDAs) in different treatments show significantly different fungal groups. CK: control without raw garlic stalk and arbuscular mycorrhizal fungi, RGS: raw garlic stalk without arbuscular mycorrhizal fungi, AMF: arbuscular mycorrhizal fungi without raw garlic stalk, ARGS: combination of arbuscular mycorrhizal fungi and raw garlic stalk

Fig. 6

LEfSE analysis of fungal communities among the different treatments. CK: control without raw garlic stalk and arbuscular mycorrhizal fungi, RGS: raw garlic stalk without arbuscular mycorrhizal fungi, AMF: arbuscular mycorrhizal fungi without raw garlic stalk, ARGS: combination of arbuscular mycorrhizal fungi and raw garlic stalk

Linear discriminant analysis effect size (LEfSE) cladogram shows differences in fungal community structure between treatments. From center to outward, the black circles represent phylum, class, order, family, genus, and species. Blue, purple, red, and green circles show taxa that were abundant in the CK, RGS, AMF, and ARGS, respectively.

Impact of physicochemical properties on the composition of fungal community

We conducted a Pearson correlation analysis on various soil edaphic factors. The objective was to identify which environmental factors are linked to the abundance of fungal taxa (Fig. 7). The results of our study showed a strong and positive relationship between fungal groups at the genus level, such as Coprinellus, Chrysosporium, and Aspergillus, with all the soil parameters, root traits, and yield, except pH (Fig. 7). In contrast, the genera Fusarium, Mortiererlla, Emericellopsis, and Haematonectra have significant negative correlation with all soil and root parameters except pH.

Fig. 7

Spearman correlation coefficients between different fungal taxon at genus level and soil properties. Red to Blue colour indicates positive to negative correlations. MBC: microbial biomass carbon, MBN: microbial biomass nitrogen, OM: organic matter, SOC: soil organic carbon, EC: electrical conductivity, AK: available potassium, AP: available phosphorus, AN: available nitrogen

Discussion

Effect of RGS amendment and AMF on root traits, soil physicochemical, enzyme activity, and eggplant yield

The incorporation of RGS and AMF significantly enhanced root traits, including root length, surface area, volume, and colonization percentage. The most substantial improvements were observed with the combined application of RGS and AMF, which resulted in significant increases compared to the control group. The enhanced root traits in AMF-colonized plants in monocropping soil could be attributed to improved root growth, root volume, and root surface area (Fig. 1A-D). AMF-colonized plants acquire more minerals and water due to the extension of mycorrhizal hyphae, which increases nutrient absorption [14, 20]. Additionally, the presence of RGS provides essential nutrients and carbon to AMF, further promoting root colonization. This, in turn, stimulates the growth of beneficial soil fungi through the incorporation of RGS in the monocropping system [21]. The higher root colonization percentage observed with the combined application of RGS and AMF aligns with previous studies, which have shown that both AMF and plant residues, whether applied separately or together, significantly impact root parameters [14, 21].

The utilization of RGS and AMF significantly influences nutrient availability in soil. However, the combined application of RGS and AMF appears to decrease nitrogen levels in the soil. [22] reported that the decomposition of garlic stalks releases compounds that increase the concentration of soil ions and macronutrients, including N, P, and K. Additionally, the allelopathic effects of garlic stalks enhance enzymatic activity, leading to elevated macronutrient levels in the soil. In the current study, the availability of N, P, and K varied among different RGS-amended treatments, influenced by the soil-to-RGS ratio [23].

In treatments with RGS and AMF, or both, carbon availability increased, suggesting that these amendments are key drivers of enhanced organic matter in the soil. These findings align with [21], and [24], who observed increased macronutrient levels in a meta-analysis of crop residue experiments. The sole application of RGS and AMF led to increase AN level. However, when RGS and AMF were combined, nitrogen availability was inhibited. This inhibition may be due to nutrient dynamics, where the balance between soil and organic substrates influences the availability of nitrogen. The combined application could have altered nitrogen cycling, potentially through competitive interactions between microbial communities or shifts in enzymatic processes.

In contrast, the combined application of RGS and AMF increased phosphorus and potassium levels. AMF has been shown to enhance the availability of these immobile nutrients through hyphae-root interactions, facilitating nutrient transport to plants. The increased availability of P and K in the combined treatment suggests a more efficient nutrient cycling system for these elements, possibly due to the synergistic effects of RGS and AMF. These findings are supported by previous studies that indicate nutrient dynamics are influenced by the ratio of soil to organic substrates. The variability in nutrient response, particularly nitrogen, is likely due to differences in nutrient cycling processes and microbial activity in response to the combined application of RGS and AMF [25, 26].

In this study, the impact of RGS on soil pH was minimal, while the effect of AMF ranged from low to moderate across different replicates. Additionally, the application of RGS, AMF, and their combination (ARGS) increased the soil’s EC. These findings are consistent with a recent study by [23], which examined changes in soil physicochemical properties following the addition of AMF and RGS as organic amendments. The increase in EC was attributed to exudates from both substrates, releasing various ions and compounds into the soil. However, RGS was identified as the primary contributor due to its higher initial EC value (669 µs cm^− 1) compared to the soil’s (582 µs cm^− 1). The combined application of RGS and AMF (ARGS) significantly increased total organic carbon, with RGS alone showing a similar, though slightly lower, effect (Table 1). Previous research has reported a similar trend, where soil co-amendments led to increased carbon availability, indicating that combining substrates effectively boosts soil organic carbon levels. A study by [27] found that decomposed raw garlic stalks resulted in the mineralization of macronutrients and soil organic carbon. This decomposition process had a positive allelopathic effect on the agro-morphological parameters of plants. According to [28], when soil is treated with a mixture of plant residue and AMF, a synergistic reaction occurs that enhances soil structure due to the carbon substrate, mainly contributed by the repeated addition of raw garlic stalks. This synergy between the two substrates likely promotes AMF growth, supported by the presence of increased soil organic carbon.

Soil enzymatic activities play a fundamental role in enhancing soil health and crop productivity by facilitating the decomposition of organic matter, a key process in nutrient cycling. These enzymes help maintain and mobilize essential macro- and micronutrients required for plant growth. Specifically, enzymes such as urease, phosphatase, and β-glucosidase play significant roles in nutrient transformation and availability. Urease catalyzes the conversion of urea into ammonia, while phosphatase releases phosphate from organic compounds, thereby increasing the accessibility of nitrogen and phosphorus to plants [29]. The application of RGS and AMF led to an increase in soil enzymatic activities, including invertase, urease, β-glucosidase, and phosphatase (Table 1). The combined application of AMF and RGS (ARGS) had a greater overall impact on urease, β-glucosidase, and phosphatase activities compared to their individual use. While AMF alone primarily drove the increased phosphatase activity, the highest levels of urease, invertase, and β-glucosidase were observed with the combined RGS and AMF treatment. Previous research has shown that soil nutrient levels strongly influence plant growth, microbial diversity, and enzymatic activity [29, 30]. Therefore, the rise in soil nutrients (Table 1) following RGS and AMF application is likely linked to the enhanced activities of urease, phosphatase, and β-glucosidase. Additionally, correlation analysis indicated a positive relationship between soil nutrients and these enzymes, supporting similar findings from earlier studies [31], confirming the role of AMF in inducing soil enzymatic activity. A study by [28] applied raw garlic stalk to soil at varying concentrations (1:100, 3:100, and 5:100 g), gradually increasing soil enzymatic activities, including invertase, urease, and alkaline phosphatase. These findings are consistent with the current study, where adding raw garlic stalk resulted in a significant rise in these enzyme activities. Similar studies [23, 27], reported notable increases in soil enzyme activities when decomposed garlic stalks were used, further supporting the current results.

Furthermore, the results of this study suggest that the incorporation of RGS and AMF has the potential to increase significantly eggplant yield, as we previously reported in [21]. A possible reason for the increase in eggplant yield compared to monocropping soil is the augmentation of soil physicochemical properties and inhibition of soil-borne pathogens after the application of AMF and RGS. Our results were further supported by the observed negative correlation between yield, and the presence of enhanced beneficial microbes (Chaetomium, Coprinellus, and Aspergillus ), and the suppression of disease-causing pathogens, such as Fusarium Oxysporum (Fig. 3b), which play a vital role in diminishing eggplant yield as previously reported by [32]. Correlation analysis confirmed a positive relationship between eggplant yield and beneficial microbes, such as AMF, indicating that microbial colonization enhances nutrient uptake and plant growth. These microbes improve soil health and increase nutrient availability, leading to higher yields [30]. Conversely, a negative correlation was found between eggplant yield and Fusarium oxysporum, a soil-borne pathogen known to cause wilt in eggplants [31]. The presence of beneficial microbes likely suppresses F. oxysporum through competition for resources and space, reducing disease incidence and promoting healthier plants (Fig. 7).

Effect of AMF inoculation and RGS incorporation on soil microbial community structure and diversity

Soil microbial communities play a crucial role in driving soil metabolism. Numerous studies have shown that the incorporation of organic amendments into the soil significantly boosts microbial activity by providing extracellular carbon, which enhances microbial abundance and alters the structure of microbial populations. PCoA analysis revealed that RGS had a more pronounced effect on soil fungal communities compared to AMF (Fig. 3). These findings are consistent with previous research, which indicates that organic amendments have a greater influence on soil microbial community structure compared to AMF alone [32]. These findings suggest that integrating organic amendments like RGS into agricultural practices, particularly in monocropping systems, could be highly beneficial. By enhancing microbial diversity and improving soil health, RGS may help mitigate the adverse effects of monocropping, such as nutrient depletion and pathogen accumulation, thus promoting more sustainable crop production.

Effect of AMF inoculation and RGS incorporation on soil microbial alpha diversity

Monocropping soil showed higher fungal α-diversity indices compared to the RGS, AMF, and ARGS treatments (Table S2). Previous studies have reported that monocropping tends to increase fungal richness [33]. Our results align with earlier findings [14], which demonstrated that AMF and plant residues reduce fungal richness compared to monocropping. This reduction in fungal richness in treated soils is likely due to AMF and RGS suppressing various pathogenic fungi while enhancing the soil microecological environment. The reduction in fungal richness observed in RGS, AMF, and ARGS treatments compared to CMC soils is significant for soil health. Although higher fungal richness in monocropping systems may indicate greater diversity, it likely includes pathogenic fungi like Fusarium oxysporum. In contrast, RGS and AMF treatments likely reduce fungal richness by suppressing pathogens and promoting beneficial fungi. This more selective microbial activity enhances plant health by improving nutrient uptake, soil structure stability, and disease suppression.

However, decreased fungal richness may also have drawbacks. A less diverse microbial community could be more vulnerable to environmental stressors, such as drought or pathogen outbreaks, which are increasingly relevant due to climate change. Over time, reduced richness might weaken soil resilience and diminish ecosystem services, potentially impacting long-term soil health and sustainability in agricultural systems.

The Effect of AMF Inoculation and RGS Incorporation on Beneficial Fungi in Eggplant Soil

AMF can attract specific microbial taxa to its hyphae, increasing both the abundance and diversity of the microbial community while enhancing their functions. Similarly, plant residues supply nutrients to the soil that AMF use to improve their activity [14]. Fungi play a crucial role in the soil ecosystem, performing key functions such as pathogenesis, residue decomposition, and forming symbiotic relationships. They also contribute to plant growth, nutrient exchange, and the recycling of organic matter and nutrients [34]. The incorporation of RGS and AMF influences the soil fungal community at multiple taxonomic levels (Fig. 4a-b). In this study, Ascomycota and Basidiomycota were the dominant phyla, accounting for 96.42% of all identified phyla.

At the phylum level, the addition of RGS and AMF inoculum significantly reduced the presence of certain phyla, such as Ascomycota and Zygomycota, while promoting the abundance of Basidiomycota. Both Ascomycota and Basidiomycota are known for their role in decomposing organic residues in agricultural soils. However, Ascomycota has a limited ability to break down lignin-rich plant residues [35]. When plant residues or straw are incorporated into the soil, Ascomycota utilizes easily degradable residue fractions to promote the rapid growth of the fungal population. However, at the later stage of residue decomposition, the labile fractions start to disappear, and Ascomycota abundance is also reduced and replaced by related decomposer Basidiomycota [35]. Our findings align with those of [35, 36], which showed that Ascomycota abundance increases in monocropping soil but decreases after the addition of crop residues and biofertilizers [37]. In contrast, Basidiomycota significantly increased after AMF and RGS were applied and decreased in CMC soil. Due to Basidiomycota’s capacity to decompose high-lignin residues, our findings align with previous studies that demonstrate a decline in its abundance in monocropping soils and an increase following the incorporation of AMF and organic residues [14].

At the genus level, the application of AMF and RGS increased the abundance of several taxa, including Chaetomium, Coprinellus, Aspergillus, and unclassified Sordariomycetes (Fig. 4b). These taxa are known for their ability to break down organic matter through enzyme production and to enhance plant and soil health by suppressing disease-causing pathogens and boosting soil nutrients [37, 38]. Chaetomium produces various cellulose-degrading enzymes like xylanase, which hydrolyzes the β-1,4 bonds of xylan, a key component of plant cell walls. Additionally, Chaetomium species generate antifungal and bioactive compounds, such as tetrahydrofuran, that inhibit numerous seed- and soil-borne pathogens. Our findings are consistent with previous studies [14, 38], which showed an increase in Chaetomium abundance in monocropping American ginseng and eggplant soils after AMF and plant residue applications. Coprinellus, an oligotrophic taxon, was present only in RGS and ARGS treatments and absent in CK and AMF, suggesting its ability to degrade organic residues. Coprinellus also plays a key role in controlling diseases like root rot in Chinese cabbage and acts as an antagonist against fusarium wilt in tomato and root rot in melon [39]. Aspergillus abundance increased following RGS application but decreased in soils treated with AMF alone. Aspergillus species are known bio-inoculants, capable of transforming insoluble nutrients into soluble forms through their P, K, and Zn solubilizing activities [40, 41]. Enzymes like amylase, cellulase, pectinase, and xylanase, produced by Aspergillus, accelerate substrate decomposition and plant residue breakdown [42]. These results align with those of [43], who observed an increase in Aspergillus abundance after incorporating rye straw. Additionally, certain species, such as Aspergillus niger, have strong antimicrobial activity against plant pathogens like Rhizoctonia solani and Fusarium oxysporum [44]. The effect of RGS on soil microbiota may be due to its direct allelopathic properties or indirectly through its ability to alter soil physicochemical characteristics. This was supported by [45], who reported that root exudates and plant residues release compounds and metabolites that drive changes in the soil microbiome near the rhizosphere.

Sordariomycetes increased in the RGS treatments but decreased in the AMF treatment, while the genus Acremonium was more abundant in AMF and lower in RGS and ARGS treatments. The mechanisms by which AMF and RGS influence the abundance of Sordariomycetes and Acremonium appear to be linked to their roles in nutrient cycling and microbial interactions. Sordariomycetes abundance increased in RGS treatments, consistent with its role in degrading plant residues and contributing to soil organic carbon (SOC) cycling [46]. The incorporation of crop residues stimulates Sordariomycetes due to the availability of easily degradable organic matter, as supported by previous findings [47]. In contrast, the abundance of Sordariomycetes was reduced in AMF treatments, possibly due to competition with AMF for resources.

On the other hand, Acremonium was more abundant in AMF-treated soils and lower in RGS and ARGS treatments. Acremonium produces extracellular enzymes and secondary metabolites that suppress other microorganisms, giving it a competitive advantage in AMF-treated soils. The reduction of Acremonium in RGS and ARGS treatments may result from antagonistic compounds produced by mycorrhizal species, which can inhibit certain soil microorganisms, as noted in previous studies [48, 49]. These findings suggest that AMF and RGS exert selective pressures on microbial communities, influencing the abundance of specific taxa based on nutrient availability and microbial interactions.

Fusarium oxysporum f. sp. melongenae (Fomg) is a major pathogen responsible for fusarium wilt in eggplant [38, 50]. The use of AMF and RGS significantly reduced the presence of Fusarium oxysporum, indicating that these treatments can effectively inhibit the pathogen and help manage Fusarium wilt in Solanum melongena L. Research has shown that exudates released by AMF’s extraradical mycelium effectively suppress Fusarium oxysporum spore germination in plant roots [51]. Additionally, garlic contains bioactive compounds like disulfides and thiosulfides, which are effective against various soil-borne fungi [38]. This aligns with earlier studies that demonstrated that combining AMF with wheat straw or garlic effectively reduces soil-borne pathogens in crops such as tomatoes and cucumbers [22, 52].

Interestingly, the genus Entoloma, which includes both saprotrophic and ectomycorrhizal species [53], was only found in the AMF treatment and was either absent or diminished in other treatments, including the combined AMF and RGS treatment. The absence of Entoloma in ARGS might be due to garlic allelopathic properties, as its organosulfur compounds could inhibit Entoloma’s symbiotic potential [54]. Incorporating these strategies in various crops or farming systems could allow farmers to utilize the allelopathic effects of certain plants to control pathogens while promoting beneficial microbes. This could be particularly advantageous in monocropping systems, where soil-borne diseases frequently threaten crop health and productivity.

Relationships between soil edaphic variables and soil fungi

The use of RGS and AMF as soil amendments has been shown to protect eggplant production and promote soil sustainability effectively. RGS and AMF influence soil physicochemical properties by enhancing nutrient availability, organic matter content, and enzymatic activities, which in turn reshape the fungal community structure. RGS contributes organic matter to the soil, serving as a substrate for microbial metabolism, while AMF enhances nutrient uptake through symbiotic relationships with plant roots. Several fungal genera (Coprinellus, Chrysosporium, and Aspergillus) have been shown to have a positive association with soil physicochemical properties (Fig. 7). These improvements in soil nutrients, such as available phosphorus and potassium, along with higher MBC and MBN, create a favorable environment for beneficial fungi like Coprinellus, Chrysosporium, and Aspergillus. These fungi degrade organic matter, suppress plant diseases, and promote nutrient cycling, further enhancing plant growth [55]. Soil enzymes, such as phosphatases and ureases, accelerate nutrient cycling, improving the availability of essential nutrients to both plants and fungi. This enriched environment supports beneficial taxa while suppressing pathogenic genera like Fusarium and Mortierella, which negatively correlate with improved soil properties. The manipulation of soil fungal communities through RGS and AMF applications, as validated by Pearson correlation analysis, supports the hypothesis that these amendments promote a more beneficial and stable fungal community, contributing to soil health and sustainability.

Conclusion

This study highlights the significant effects of RGS and AMF application on soil properties and fungal community composition in eggplant monocropped soil. The findings confirm that applying these organic amendments, either separately or together, enhances soil quality by addressing nutrient deficiencies. Co-amended soils treated with RGS and AMF exhibited elevated levels of phosphorus, potassium, and organic carbon, indicating the potential of these treatments for nutrient cycling and improving soils degraded by continuous monocropping.

The observed increase in soil enzymatic activities following the application of organic substrates and AMF, underscores their role in facilitating organic matter decomposition and nutrient mineralization within the carbon cycle. Additionally, a substantial shift in the microbial community structure was noted, with both amendments increasing the diversity and abundance of beneficial fungi while suppressing pathogenic species, ultimately resulting in improved eggplant yields.

In conclusion, this study supports the use of raw garlic stalk and arbuscular mycorrhizal fungi as effective organic amendments for restoring nutrient-deficient, pathogen-laden monocropped soils. Further research should explore long-term field trials with different crops under diverse environmental conditions, along with in-depth microbiome analyses to enhance our understanding of soil ecosystem dynamics.

Materials and methods

Preparation of experimental material and AMF inoculum propagation

A plastic tunnel experiment based on a pot experiment with eggplant was conducted at Northwest A & F University, located in the Yangling district of Shaanxi Province, China. The soil used in this experiment was obtained from the university’s plastic tunnel, where eggplant had been continuously grown for the last six years. This soil had been subjected to extensive and continuous application of chemical and inorganic amendments. As a result of the improper management of these treatments, the soil in this area has become degraded, and Fusarium wilt disease is commonly observed [38, 50]. According to the FAO classification, the soil is categorized as anthrosol. This soil type was selected as it represents a typical example of long-term agricultural use, providing a realistic context for studying soil degradation and disease incidence, as previously reported in the literature [56]. Table S1 provides an overview of the key properties of the soil and RGS. RGS was collected from a garlic-producing region near Yangling, where garlic is widely cultivated. This organic material, including stalks and leaves, was allowed to dry naturally, ground to a powder (sieve > 2 mm), and kept in a dark place at room temperature until ready for use.

This experiment employed AMF isolates (Glomus versiforme), and accession number (BGC NM03C) acquired from the Beijing Academy of Agriculture and Forestry Sciences. In brief, the principal AM inoculum was produced by cultivating maize as a trap crop in the greenhouse. Maize plants were grown under controlled conditions with a daytime temperature of 25 ± 2 °C and a nighttime temperature of 16 ± 2 °C, a relative humidity between 70 and 75%, and a photosynthetic photon flux density of 750 µmol m⁻² s⁻¹. The final inoculum contained approximately 150 spores in 100 g inoculum along with hyphal fragments and colonized root segments. The inoculum density of 150 spores per 100 g of soil was chosen based on previous studies. Similar inoculum densities have been used in research investigating the effects of AM fungi on plant growth and nutrient uptake. Previously, it was reported that an inoculum density of 120 spores per 100 g of soil promoted plant growth in a greenhouse setting [57, 58].

Description of Pot Experiment

Eggplant seeds (Solanum melongena L. var. Tai Kong Qie Wang) were disinfected by soaking in hydrogen peroxide (H₂O₂) for 20 min and then rinsed thoroughly with deionized water. Following this, the seeds were sown into trays containing commercially available seedling medium. After germination, the seedlings were transplanted into plastic pots (30 cm in height and 24 cm in diameter) filled with 8 kg of soil. The RGS treatment was applied at 3 g per 100 g of dry soil, either alone or in combination with AMF, as established in previous studies [5, 50]. Similarly, 25 g of AMF (Glomus versiforme) inoculum was incorporated at the base and surrounding area of seedling roots individually or with RGS. A completely randomized design was adopted, consisting of four different treatment groups, each replicated three times (10 pots/replicate, 30 pots/treatment, and 120 pots for the entire experiment): (i) CK: control (no RGS or AMF); (ii) AMF-only treatment; (iii) RGS-only treatment; (iv) AGRS: a combination of AMF and RGS. Each pot received an equal amount of 10 g of PengDiXin organic fertilizer (30.03% organic matter, 2.55% nitrogen, 2.58% phosphorus, 1.23% potassium, plus trace elements) and 10 g of compound fertilizer (18:18:18 N: P).

Soil sampling

Following the eggplant harvest, fresh rhizosphere soil samples were collected from five pots per replicate, which were then combined to form a composite sample. A total of 15 samples from each treatment group (5 pots per replicate) were placed in an icebox and brought to the laboratory. The samples were then separated into two parts: one portion was stored at -80 °C in sterile Falcon tubes for DNA extraction, and the other was air-dried for soil chemical analysis.

Measurement of root traits

The root traits (root length, surface area, and volume) were assessed using WinRhizo, 2007d software with a Hewlett Packard scanner (Model- J221 A, Seiko Epson Corporation, Japan). After carefully washing roots, their roots were separated on the plexiglass tray filled with a 3-4 mm water layer. The water level was adjusted according to the size of the roots. EPSON PERFECTION V700 Photo Flatbed Scanner (Delta-T Area Meter Type AMB2; Delta-T Device Ltd., Cambridge, UK) with a resolution of 6400 dpi × 9600 dpi was used for scanning.

The calculation of the root colonization percentage was assessed following the method outlined by [56]. A total of 50 root segments of eggplant roots with a length of 0.5 to 1 cm were examined for each treatment. The root colonization % was determined according to the formula:

Root colonization (%) = number of observed root segments/number of colonized root segments) ×100.

Assessment of soil chemical and biological properties

Soil pH and electrical conductivity (EC) 1:5 (w/v) were assessed using a pH meter and a microprocessor conductivity meter, respectively. The dichromatic oxidation method was adopted to assess soil organic carbon [59].

Shi (1996) [60], an alkali-hydrolyzed diffusion approach was employed to estimate available nitrogen (AN), While available phosphorus (AP) was determined as described by [61]. Available K (AK) was estimated according to the procedure proposed by [62].

Chloroform fumigation-extraction procedure were used to evaluate microbial biomass carbon (MBC) and microbial biomass nitrogen (MBN), as described by [63]. To compute the microbial biomass, a conversion factor of 0.45 was used for MBC, and a factor of 0.54 was used for MBN [35].

Soil enzymatic activities

The activities of soil enzymes such as invertase, urease, phosphatase, and β-glucosidase were measured using colorimetric methods. The measurement of invertase activity was conducted by utilizing sucrose solution as a substrate. Following a 24 h incubation at 37 °C, the amount of glucose released was measured using colorimetric analysis [64]. The urease activity was quantified by assaying the amount of ammonium (NH⁺ ₄) released from a soil incubation containing a (10%) urea solution and citrate buffer, pH 7.6 for 24 h at 37 °C Alkaline phosphatase activity was assayed using p-nitrophenyl phosphate (pNPP) as the substrate at pH 9.6 [65]. The activity of β-glucosidase activity was assayed through a colorimetric assay by determining the amount of p nitrophenyl from p-nitrophenyl-β-D-glucopyranoside (PNG). The colorimetric analysis was performed by measuring the absorbance of p-nitrophenol at 405 nm using a spectrophotometer, with the absorbance being directly proportional to the concentration of p-nitrophenol released by β-glucosidase [64].

Soil DNA extraction and PCR amplification

To extract microbial DNA from each composite soil sample, 0.5 g of soil was processed using the E.Z.N.A.® Soil DNA Kit (Omega Biotek, Norcross, GA, USA) according to the manufacturer’s recommended protocol. DNA was eluted from each soil sample thrice, with 50 µL of elution buffer used for each extraction. The total volume was determined based on the manufacturer’s recommendation to optimize DNA yield while maintaining concentration for downstream applications. The integrity and concentration of extracted DNA were estimated using a spectrophotometer (NanoDrop 2000, Thermo Scientific, USA). For PCR amplification, the fungal transcribed spacer (ITS) region of 18S rRNA was targeted using ITS1F as a forward primer (CTTGGTCATTTAGAGGAAGTAA) and ITS2R as a reverse primer (GCTGCGTTCTTCATCGATGC) as described by [63]. Triplicate Polymerase chain reaction (PCR) reactions were executed in a 20 µL hot master mixture with 4 µM of 5 × FastPfu Buffer, 2 µL of 2.5 mM dNTPs, 0.8 µL of each primer (5 µM), 0.4 µL of FastPfu Polymerase, and 10 ng of template DNA. The PCR conditions were as follows: initial denaturation of DNA at 95 °C for 2 min, followed by 25 cycles at 95 °C for 30 s, annealing for 55 s, and terminal extension for 5 min at 72 °C. The amplicons were sent to the Majorbio Cloud Platform (http://www.majorbio.com/) and analyzed on a 2% agarose gel; and then purified using the AxyPrep D.N.A. Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions, and quantification was done with QuantiFluor™-ST (Promega, US).

Bioinformatics analysis

The ITS gene pool raw reads were identified and clustered into the individual correspondent sample by processing through the QIIME (V1.9.1) pipeline under stringent cleaning protocols. The term “stringent cleaning protocols” refers to specific steps taken to ensure data quality, including the removal of low-quality sequences, trimming of ambiguous bases, and filtering out chimeric sequences. These steps are crucial for obtaining reliable and accurate taxonomic assignments, thereby enhancing the robustness of the subsequent analyses. Subsequently, the high quality sequences obtained underwent the UPARSE clustering procedure, where they were assembled into operational taxonomic units (OTUs) with a 97% sequence similarity threshold, following the method outlined by (Edgar and Robert, 2013). Taxonomic analysis of individual ITS genes was performed using the RDP Classifier algorithm (http://rdp.cme.msu.edu/) against the UNITE database (Release 6.0, http://unite.ut.ee/index.php). database. The RDP Classifier is a tool that assigns taxonomic classifications to DNA sequences based on a reference database. It was chosen for the taxonomic analysis in this study due to its efficiency and accuracy in processing large datasets, making it well-suited for high-throughput sequencing data. Alpha- and beta-diversity indices, including Bray-Curtis, and UniFrac distance, were calculated using QIIME. Shannon index was calculated using the following formula:

$$\:{H}_{shanon}=\:-\:\sum\:_{i=1}^{{S}_{obs}}\frac{{n}_{i}}{N}\text{ln}\frac{{n}_{i}}{N}$$

Where,

Sobs = the number of observed OTUs.

ni = the number of individuals i.

N = the total number of individuals in community.

Statistical analysis

The data of soil physicochemical properties and α diversity among different treatments were measured through a completely randomized design, one-way ANOVA, followed by Tukey's HSD test a 5% significance level using IBM SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). UPGMA (unweighted pair group method with arithmetic mean) clustering analysis was used to exhibit the difference in community composition through a hierarchical representation of sample relationships based on similarity. This method groups samples according to their similarities and dissimilarities, providing a visual depiction of microbial community composition and trends. Principal coordinate analysis (PCoA) was employed to visualize variations among samples in a multidimensional space, capturing the primary axes of variation and illustrating how samples cluster based on their similarities. PCoA simplifies the data by reducing dimensions while retaining variance, thereby offering insights into the structure and relationships within microbial communities. The LEfSe algorithm was used to identify significant differences in microbial communities based on different taxonomic levels (https://huttenhower.sph.harvard.edu). A Venn diagram was structured based on unique and shared OTUs among treatments by using R (version 3.3.0) software. Biomarker features among the sampling groups were further screened using Metastats and LEfSe algorithm. Differentially abundant fungal taxa were calculated using linear discriminant analysis (LDA) and effect size (LEfSe) analysis. Pearson correlation was executed using the R (version 3.3.0) software.

Data Availability

All data generated or analyzed in this study are provided within this article and its supplementary information files. Additionally, the raw sequences of soil fungi used for data analysis have been deposited in the NCBI Sequence Read Archive under BioProject PRJNA1060939.