From: Ecological distribution and genetic diversity of Azolla in Uganda
Primer name | Primer sequence | Reference | Targeted locus | Sequence Length (bp) |
---|---|---|---|---|
ITS1 ITS4 | 5′ TCCGTAGGTGAACCTGCGG 3′ 5′ TCCTCCGCTTATTGATATGC 3′ | [32] | Internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2 | 984 |
N-F N-R | 5′ GGTTCAAGTCCCTCTATCCC 3′ 5′ ATTTGAACTGGTGACACGAG 3′ | [26] | trnL – trnF intergenic spacer | 409 |
SCAR-F SCAR-R | 5′GACATATCCACCTATCGTCTCTGTC 3′ 5′AGACAACTTCGATAGTCACAGTTCC 3′ | [1] | Internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2 | 842 |
18Sr-F 18Sr-R | 5′ AGGGTTCGATTCCGGAGA 3′ 5′ CCTTCCGTCAATTCCTTTAAG 3‘ | [6] | trnL gene and trnL-trnF intergenic spacer | 1029 |