Skip to main content

Table 3 Sequence of primers used for real-time qRT-PCR in Damask rose

From: Biochemical and molecular responses of Rosa damascena mill. cv. Kashan to salicylic acid under salinity stress

Gene name (MDP ID) Abbreviation Primer sequence (5′–3′) Fragment Length (bp) Amplification efficiency (%) Coefficient of Determination R2
SAND family protein RC5G0507300 SAND Forward Primer: GTGGAGGTGGTGGTATTCTG
Reverse Primer: CTAACTGCCGCAATCTCATC
151 91.3 0.999
protein phosphatase 2A PP2A Forward Primer: AACTGTCGAACCAGCTCATC
Reverse Primer: ATTTGTCCTGCGAGAAGTTG
185 95.5 0.992
Elongation factor 1-alpha RC5G0521000 EF1 Forward Primer: TGAAGCTGGTATCTCCAAGG
Reverse Primer: GGTGGCATCCATCTTGTTAC
106 92.5 0.999
Tubulin alpha-2 chain TUB Forward Primer: GTTGGTGGTGGTACAGGTTC
Reverse Primer: TTCAAGGAGGGCATGAGTAG
168 93.8 0.999
Ascorbate peroxidase RC5G0530600 APX Forward Primer: GGTTACTGGTGGACCTGATG
Reverse Primer: GTGGTCAGAACCCTTGACAG
103 90.1 0.999
Catalase RC7G0342400 CAT Forward Primer: CCATTATTGTCCCTGGTGTC
Reverse Primer: TGTTGTGGTGAGCATTCTTG
144 92.3 0.998
Peroxidase RC5G0029500 POD Forward Primer: GCAGAGCAGAGATCCTTGAG
Reverse Primer: TTCAGAGCTGGGTCAACTTC
190 91.3 0.998
Fe- Superoxide dismutase RC4G0497500 FeSOD Forward Primer: CTGTTGCTTGAAATGCTTTG
Reverse Primer: AGGGCAACTCAGCACAATAG
171 91.7 0.990
Cu- Superoxide dismutase RC3G0373000 CuSOD Forward Primer: GAGATGGCCCAACTACTGTG
Reverse Primer: AGCAGGATTGAAGTGTGGTC
128 94.5 0.999