Skip to main content

Table 1 Primer sequences and GenBank accession numbers for HEMA1, CHLH, HEMH, GUN4, HO1, and GAPDH genes

From: Heme is involved in the exogenous ALA-promoted growth and antioxidant defense system of cucumber seedlings under salt stress

Gene symbol Accession number Forward primer Reverse primer
HEMA1 NM001280574.1 CGGTGGGTAAACGGGTAAGAACAG ATTCTGGCAGTGGCATGTGAAGG
CHLH XM004149349.3 CCTGATAACACCAACGGCCTTCC CTTGTACGGCGGCTGTGAGTG
HEMH NM001308874.1 GAAGCCCTTCCATCCGCAACG AAGATGAACGCAAGGACCGAACC
GUN4 XM004140838.3 TCACCACCACCACCACCACTAC GCGGAGGAGGTGTCTGAGGAG
HO1 HQ198046.1 GAGGAGATGAGGTTTGTGGCGATG GTCGGCTCCCATTTAGCAACAGG
GAPDH NM001305758.1 AGTAGCCAAACCATCTATTCAGGC CAAGTGGGGAATCCTTGCGT