Skip to main content

Table 4 Identification of new conserved miRNA families in Brassica napus

From: Identification of miRNAs and their target genes in genic male sterility lines in Brassica napus by small RNA sequencing

bna-miRNA Sequence Len Read pre-position
bna-miR158a.1-5p CUUUGUCUAUCGUUUGGAAAAG 22 3884 chrA08:2748114..2748220
bna-miR158a.1-3p UUUCCAAAUGUAGACAAAGCA 21 32,292  
bna-miR158a.2-5p CUUUGUCUAUCGUUUGGAAAAG 22 3884 chrC08:3581242..3581348
bna-miR158a.2-3p UUUCCAAAUGUAGACAAAGCA 21 32,292  
bna-miR159b.1-5p AGCUGCUAAGCUAUGGAUCCC 21 258 chrA02:9865184..9865001
bna-miR159b.1-3p UUUGGAUUGAAGGGAGCUCUA 21 46,073  
bna-miR159b.2-5p AGCUGCUAAGCUAUGGAUCCC 21 258 chrA07_random:1944377..1944191
bna-miR159b.2-3p UUUGGAUUGAAGGGAGCUCUA 21 46,073  
bna-miR159b.3-5p AGCUGCUAAGCUAUGGAUCCC 21 258 chrC02:19215807..19215624
bna-miR159b.3-3p UUUGGAUUGAAGGGAGCUCUA 21 46,073  
bna-miR159b.4-5p AGCUGCUAAGCUAUGGAUCCC 21 258 chrC06:33954934..33954749
bna-miR159b.4-3p UUUGGAUUGAAGGGAGCUCUA 21 46,073  
bna-miR319a-5p AGAGCUUCCUUGAGUCCAUUC 21 27 chrC01:10651723.. 10,651,921
bna-miR319a-3p UUGGACUGAAGGGAGCUCCCU 21 4848  
bna-miR319b-5p GGAGAUUCUUUCAGUCCAGUC 21 4 chrC04:46407584.. 46,407,846
bna-miR319b-3p UUGGACUGAAGGGAGCUCCUU 21 27,901  
bna-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 110 chrA10:10707678..10707812
bna-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 237  
bna-miR398a-5p GGGUCGACAUGAGAACACAUG 21 141 chrA03:2288822..2288945
bna-miR398a-3p UGUGUUCUCAGGUCACCCCUG 21 9870  
bna-miR398b-5p GGAGUGUCAUGAGAACACGGA 21 25 chrC02:37793584..37793689
bna-miR398b-3p UGUGUUCUCAGGUCACCCCUU 21 145  
bna-miR400-5p UAUGAGAGUAUUAUAAGUCAC 22 78 chrAnn_random:40582790..40582930
bna-miR400-3p GACUUAUAAUGAUCUCAUGAA 22 237  
bna-miR408a.1-5p GGGAGCCAGGGAAGAGGCAGU 22 1232 chrA05:478954..479121
bna-miR408a.1-3p UGCUUGUUCCCUGUCUCUCUC 22 1002  
bna-miR408a.2-5p GGGAGCCAGGGAAGAGGCAGU 22 1232 chrCnn_random:8448205..8448064
bna-miR408a.2-3p UGCUUGUUCCCUGUCUCUCUC 22 1002  
bna-miR9554-5p GAAUGAUACUUGGAUAUAAUC 21 5 chrA06:19718101..19718250
bna-miR9554-3p UCAUAUCCAAGUAUCAUUCCU 21 81  
bna-miR9558-5p AGAGAUGUCUGGCUUGCAACA 21 3 chrC03_random:1702602..1702746
bna-miR9558-3p UUGCAAGCCAGACAUUUCCUUU 22 8  
bna-miR9559-5p UUUGGAUUUUGGUCAUUGUUG 21 5 chrAnn_random:36404086.. 36,404,194
bna-miR9559-3p ACAAUGAACGAAAUCCAAAUC 21 3  
bna-miR9560a-5p ACAGGUGGUGGAACAAAUAUGAGU 25 30 chrA06:19552830..19552965
bna-miR9560a-3p UCAUAUUAGUUCUACCUCCUGCUG 25 2  
bna-miR9562-5p ACUAUGCAAUUGUGAACAAAC 21 4 chrA02_random:1408210..1408358
bna-miR9562-3p UUAUUCACAACUGCAUAAUUC 21 3  
bna-miR9563a-5p ACCCGUCUCUUAACUUUUAAC 22 15 chrAnn_random:9932700..9932850
bna-miR9563a-3p UAAAAGUUAAGAGACAAGUUA 22 17  
bna-miR9568-5p UGCGGAUAUCUUAGGAUGAGGU 22 13 chrA03:13274664..13274813
bna-miR9568-3p UCAUCGUAAGAGAUCUGCAUU 21 2  
bna-miR9569-5p UGAGUUAUCAUUGGUCUUGUG 21 1198 chrAnn_random:21855323..21855514
bna-miR9569-3p ACACAGGAACAAUACUAACUCAUU 24 3509  
  1. Len length of mature miRNA, pre-position the miRNA precursor sequences in chromosomes of Brassica napus, Read the total read count of all the small RNA libraries