Skip to main content

Table 3 Identification of novel miRNAs on the other arm of known pre-miRNAs in Brassica napus

From: Identification of miRNAs and their target genes in genic male sterility lines in Brassica napus by small RNA sequencing

bna-miRNA name mature miRNA sequence Length Read count
bna-miR156f-3p GCUCACUGCUCUUUCUGUCAGA 22 749
bna-miR156e-3p UGCUCACCUCUCUUUCUGUCAGU 23 344
bna-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 32
bna-miR160c-3p GCGUACAGAGUAGUCAAGCAUG 22 24
bna-miR160d-3p GCGUACAGAGUAGUCAAGCAUG 22 24
bna-miR161-3p GUCACUUUCAAUGCGUUGAUC 21 7
bna-miR164b/c/d-3p CACGUGUUCUACUACUCCAAC 21 21
bna-miR166d-5p GGACUGUUGUCUGGCUCGAGG 21 135
bna-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 10
bna-miR166f-5p GGAAUGUUGUCUGGAUCGAGG 21 202
bna-miR167a/b-3p GAUCAUGUUCGCAGUUUCACC 21 750
bna-miR167a/b-3p GAUCAUGUUCGCAGUUUCACC 21 750
bna-miR168a-3p CCCGCCUUGUAUCAAGUGAAU 21 104
bna-miR171a/b/c-5p AGAUAUUAGUGCGGUUCAAUC 21 51
bna-miR171d-5p AGAUAUUGGUGCGGUUCAAUC 21 12
bna-miR172a-5p GCAGCACCAUCAAGAUUCAC 20 48
bna-miR172b-5p GCAGCAUCAUUAAGAUUCACA 21 3
bna-miR172c-5p GCAGCAUCAUCAAGAUUCACA 21 9
bna-miR172d-5p GCAUCAUCAUCAAGAUUCAGA 21 218
bna-miR2111d-3p AUCCUCGGGAUACGGAUUACC 21 25
bna-miR390b-3p CGCUGUCCAUCCUGAGUUUCA 21 1109
bna-miR390c-3p CGCUAUCCAUCCUGAGUUCC 20 19
bna-miR395a/b/c-5p GUUCCUCUGAGCACUUCAUUG 21 61
bna-miR395d/f-5p GUUCCCUUUAACGCUUCAUUG 21 13
bna-miR399b-5p GGGCAAGAUCUCUAUUGGCAGG 22 12
bna-miR403-5p UGUUUUGUGCGUGAAUCUAAUU 22 287
bna-miR824-3p CCUUCUCAUCGAUGGUCUAGA 21 1640
  1. Read count, the total read count of all the small RNA libraries