Skip to main content

Table 1 Gene-specific primers used for cloning and qRT-PCR

From: Overexpression of γ-glutamylcysteine synthetase gene from Caragana korshinskii decreases stomatal density and enhances drought tolerance

Gene Forward primer (from 5′ to 3′) Reverse primer (from 5′ to 3′)
Ckγ-ECS(cloning) ATGGCTATCATCTCCCGA ATAAAGCAACCTCAAATA
Ckγ-ECS TGCGAGCTCATGGCTATCATCTCCCGA CGGCTGCAGATAAAGCAATTCCTCAAATA
qCkUB GACTTTGACCGGGAAGACCA CACCACGAAGACGGAGCACA
qCkFAMA TGAACGTAGGAACCAGGCA AACAAGAGGAAGAGACCAAGAAG
qCkAXR3 CTGGAAGATGTTTGTGGAATCA AGGGACATTTACATCGTCATTACAC
qCkARF5 GTCAGTGTGCCTCGTCGTCTC TGTCCTCCCCGTTAATCTTCA
qCkSTOMAGEN AATCCTCACAACCTCAAAGAGAACT TGGGGTCATTTCCCTCCACAGG
qCkγ-ECS AAGTTGGTTCTCTCGGGCT CGGTGCTTATCAGTATCGGTC
qAtActin7 CACTACCGCAGAACGGGAAA GCGATGGCTGGAACAGAACC
qAtFAMA CAGCAACATCAACTCTCTCCTTCC TCTGGTCTGGTTCAACGCAA
qAtAXR3 CTCTTTTACCATGGGCAAACATGGA AGGGAACATAGTCCCAGCTATTCA
qAtARF5 TAATGGGGAATGGAGGTTTG GTGTAGAGTTCTCAGGTTTAGCAG
qAtSTOMAGEN TAGGGTCGACAGCACCAACTTGTAC TCATTTCCTTCGACTGGAACTTGCT
qAtERF1 TTCTTCTCCTTGCCTTTTTCC AACCTAGACCCAGCCACCTG
qAtγ-ECS CTGTTAAGAGGAGTAAGAGAGGGC CCAGAGGCAAGATAGGCAATG