Skip to main content

Table 3 Primers used in this study

From: Genome-wide identification, gene cloning, subcellular location and expression analysis of SPL gene family in P. granatum L

Primer Primer sequence(5′-3′) Annotation
PgSPL5 F: ATGTTGGACTATGAATGGGC
R: TCACCCGCTAGAGAAAAAGAG
Gene clone
PgSPL13 F: ATGGGATCAAGAAGAAACCTCGAAG
R: TCAGTTTGAGCCTTCTCCAGGAAAA
Gene clone
GFP-PgSPL5 F:gagaacacgggggactctagaATGTTGGACTATGAATGGGC
R:gcccttgctcaccatggatccTCACCCGCTAGAGAAAAAGAG
subcellular localization
GFP-PgSPL13 F:gagaacacgggggactctagaATGGGATCAAGAAGAAACCTCGAAG
R:gcccttgctcaccatggatccTCAGTTTGAGCCTTCTCCAGGAAAA
subcellular localization
qRT-PgSPL2 F:AAGAGAGACTTCACCACCGAG
R: GTGAAACCTGCTGCATTGCT
Gene expression
qRT-PgSPL3 F: AACAGCCGAGACTCATCCC
R: GAGGTCCTTGTTACACCCGTA
Gene expression
qRT-PgSPL5 F: GAAATCTCAGCAACAGCCGAAT
R: CTTTGCCTGAAACAAGAGTCG
Gene expression
qRT-PgSPL6 F: AATGCAGCAGGTTTCATTCCC
R: TCGTTTTCCGACTTGACAGC
Gene expression
qRT-PgSPL11 F: TTCCCAGCCATTCCATCCTCG
R: GGCTTCGCTATACCAAGTCCT
Gene expression
qRT-PgSPL12 F: AAGTCCCCTAAAGTCATCGTT
R: TGAAGTCCATCACAAAGCCT
Gene expression
qRT-PgSPL13 F: CGACAACTGCACGACCGAT
R: CGGCAGCTTCTTTTCGCTTC
Gene expression
qRT-PgSPL14 F: TCGACGATACCAAGAGAAGCTG
R: AATTCTCCCCCGATCATCGAC
Gene expression
PgActin F: AGTCCTCTTCCAGCCATCTC
R: CACTGAGCACAATGTTTCCA
Gene expression