Skip to main content

Table 4 The primers used for the quantitative relative expression analysis of genes related to floret development

From: A homologous gene of OsREL2/ASP1, ASP-LSL regulates pleiotropic phenotype including long sterile lemma in rice

Primer Sequence 5’ →3’
OsMADS1-F TCTTGGTGAGGATTTGGGC
OsMADS1-R CCTTGCTCTTCAGATCAAACAG
OsMADS3-F AACGCAAACAGTAGGACCATAGTG
OsMADS3-R CCCCTCTCATTCTCAACAACC
OsMADS4-F AGCACAAGATGTTGGCTTTTAGGG
OsMADS13-F ATGGGGAGGGGCAGGATTGAG
OsMADS13-R TGCGCCTTCTTGTACCTGTCA
OsMADS16-F CGAGGCGTACGAGACTCTGC
OsMADS16-R ACCACGCGGAAGGCGAACAT
DL-F CCCATCTGCTTACAACCGCTT
DL-R GTTGGAGGTGGAAACCGTCG
MFS1-F CGGCTCGTGATCTCGACACGTAC
MFS1-R CACAGCCGGACCAGTGCTCTC