Skip to main content

Table 2 Attributes of two cpDNA and ten ISSR primers used in the present study

From: Population genetic structure and connectivity of a riparian selfing herb Caulokaempferia coenobialis at a fine-scale geographic level in subtropical monsoon forest

Primer Sequence 5´to 3´ T/°C Annealing temperature SR NT NP
cpDNA
 trnL intron F: CGAAATCGGTAGACGCTACG 48    
R: GGGGATAGAGGGACTTGAAC     
 psbJ-petA F: ATAGGTACTGTAR*CYGGTATT 52    
R: AACAR*TTY*GAR*AAGGTTCAATT     
ISSR
 807 (AG)8 T 52 230–1500 21 20
 808 (AG)8C 52 180–1700 20 19
 810 (GA)8 T 52 210–1520 22 22
 835 (AG)8Y*C 58 170–1700 19 17
 836 (AG)8Y*A 50 250–1700 20 20
 840 (GA)8Y*T 52 200–1500 22 22
 841 (GA)8Y*C 52 180–1780 23 22
 847 (CA)8R*C 52 280–1700 24 24
 859 (TG)8RC 49 290–1700 24 24
 887 DVD*(TC)7 52 220–1700 23 23
Total - - - 218 213
  1. *Y: C/G, R: A/T, D: A/G/T; SR Size range of amplified fragments, NT Number of total bands, NP Number of polymorphic bands