Skip to main content

Table 1 The primer sequences for real-time PCR

From: Metabolomic insights into the browning of the peel of bagging ‘Rui Xue’ apple fruit

Gene name Gene ID Forward primer sequence Reverse primer sequence
MdActin MD12G1140800 TGACCGAATGAGCAAGGAAATTACT TACTCAGCTTTGGCAATCCACATC
MdDFR MD15G1024100 AGGAACTGTGAATGTGGAGGAGC AGGAACTGTGAATGTGGAGGAGC
MdANS MD06G1071600 TCCCAAAAGAGTACATCAGACCTAA ACACCCCAGTCCACAGTTGC
MdLAR MD16G1048500 TCTTGGCCCTACTTTGACAAC AGAGTTCCCACTTCCACATCA
MdANR MD10G1311100 CCACCTCACAGCACTACAAGAG GCAAATTTCCAAGCTGTCTTCT
MdUFGT MD01G1234400 GCAAGCCGCAGGAGGACATA CGGAGATCCAGAAAGTGACCCA
MdLAC7 MD04G1142300 ATGGCACGGTTAGCCTTT CTAACATTTCGGCAGATCAAGT
MdLAC12 MD01G1159400 TGGAGGCACTCAACGCATTT GATCTATAGATTCTTAACAA
MdLAC14 MD02G1264400 ATGGCCTCAGACAAGAAAATAC CTAAGACTTGGAACAAGGAGGCA
MdLAC15 MD07G1308000 ATGAGTATTTTAATTAGCTTGC ACATGGAGGCATTCCTTGTGG
MdLAC16 MD07G1307400 ATGCATCTCCACGGATTCAG TGTTAACATGGAGGCATTCC