Skip to main content

Table 2 Primers used to amplify the target genes for qRT-PCR analysis

From: QTLs and candidate genes analyses for fruit size under domestication and differentiation in melon (Cucumis melo L.) based on high resolution maps

Gene Forward primer Reverse primer
MELO3C025758 ATGTTCACCTACTCGCCAATAAG CTCCATTCAACGC CAATTCCT
Actin TTACGGAAACATCGTCCTCAG GAATAGACCCTCCAATCCAAAC