Gene | Accession | Primer Sequence (5′ → 3′) a | Protein | Ortholog gene in Arabidopsis | Function | Reference (s) |
---|---|---|---|---|---|---|
rty | AY050987 | F: AAGCTTATGAGC GAAGAACAACCACACGC R: GAGCTCTTACAT TTCGAGATTATTATCACTC | tyrosine aminotransferase | AT2G20610 | Regulation of cell growth by extracellular stimulus, glucosinolate biosynthetic process, adventitious root development, indoleacetic acid biosynthetic process | [6] |
NPTII | AAL92039 | F: CCGGTATAAAGGGACCACCT R: ATGTTGCTGTCTCCCAGGTC | neomycin phosphotransferase II | – | Neomycin phosphotransferase II as selectable markers in transformed plant screening | [81] |
Actin | XM_004306544 | F: GGCCGTTCTCTCTCTGTATGC R: TTCTGGGCACCTGAATCTC | Actin | – | Actin | [29] |
FvRD29A | XM_011472069 | F: AGAGGCACGCCACGAATA R: GCCAGTTTGGTCCTTGCT | Cold regulated protein | AT5G52310 | Responded to abscisic acid, cold, desiccation, mannitol, osmotic stress, reactive oxygen species, salt stress, water deprivation, and wounding | [34] |
FvNCED3 | XM_004300619 | F: TCACCACAAGAGATTCCTTTCT R: ATGGCTGTGAGTAGGTTGGA | Encodes 9-cis-epoxycarotenoid dioxygenase | AT3G14440 | Regulated in response to drought and salinity | [32] |
FvDREB2A | XM_004307642 | F: TGCTGCGAGTCTACTACGATGTCT R: TGATCCATAGGAACCTCGCTTT | Encodes a transcription factor binds to DRE/CRT cis elements | AT5G05410 | Regulates expression of many water stress–inducible genes. | [35] |
FvABA8 | XM_004300635 | F: ATGGAACTACTCAGCCTCAACT R: ATGGCGAGCGGAAATGAG | Encodes a protein with ABA 8′-hydroxylase | AT4G19230 | Involved in ABA catabolism. | [46] |
FvABI1 | XM_011469096 | F: GCATGGCTAAAGCTAGTAACAGAC R: GCTCCTCCAGTGTTATCTTCTTGT | Protein phosphatase 2C family protein | AT4G26080 | Involved in abscisic acid (ABA) signal transduction | [33] |
FvPYL9 | XM_004306638 | F: GGGAGTCTTAGGGAAGTGAATG R: GGATGGACGGTGATAATAGAAGAG | Encodes regulatory components of ABA receptor | AT1G01360 | Interacts with and regulates the type 2C protein phosphatases (PP2Cs). | [78] |
FvPP2C | XM_004291463 | F: ACGAAATATGCCGAGAAGCGAAAG R: TTGGCGGAAATCGTTAGGCTCAT | Encodes a member of the group A protein phosphatase 2C | At1g07430 | Negative regulation of abscisic acid-activated signaling pathway. | [36] |
FvAAO1 | XM_004296223 | F: TCAACCGCTGCTCCATCACG R: GTCGGTCAGTGGTGTTTTGGGC | Encodes aldehyde oxidase 1 | AT5G20960 | Involved abscisic acid biosynthetic process, auxin biosynthetic process. | [76] |
FvPIN1 | XM_004303589 | F: CAAAGCCGCAAAGATAGAGCC R: TGGGATGCCCTGACCTGAT | Encodes an auxin efflux carrier involved in shoot and root development | AT1G73590 | Involved in the maintenance of embryonic auxin gradients | [82] |
FvARF7 | XM_004287612 | F:ACAATCACTGGCATTAGCGAGC R: GAGGTGGGCAGATGTAGAAAGG | Encodes an auxin-regulated transcriptional activator | AT5G20730 | Involved in auxin-activated signaling pathway, lateral root development, lateral root formation. | [83] |
FvMAX2 | XM_011468656 | F:ACTGTGGCGATTTGACGGAT R: CCACAACAAAGAAGCCAGCGT | F-box leucine-rich repeat family of proteins | AT2G42620 | Responses to abiotic stress conditions. | [84] |
FvYUC1 | JF898837 | F: CAAATGGTTGGAAAGGTGAGC R: CGAGGACATTGAGCGGTGTTGGA | Encodes a member of the YUC family | AT4G32540 | Involved in auxin biosynthetic process. | [72] |
FvYUC3 | JX417080 | F: ATTTCCCAACCTACCCAACC R: AGTCTTGACGAGCCAAAGTC | Encodes a member of the YUC family | AT1G04610 | Involved in auxin biosynthetic process, oxidation-reduction process, response to ethylene. | [72] |
FvGA3ox | XM_004302902 | F: CCTGTAAGAATCTCCGAAGCC R: CGTGTAGTGAGTTGAAGTCTGC | gibberellin 3-beta-dioxygenase activity, | AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. | [85] |