Skip to main content

Table 1 Specific primer pairs used for ORF cloning, qPCR, and recombinant plasmid construction. 26S-2 was used as an internal control genes

From: Phosphate transporters, PnPht1;1 and PnPht1;2 from Panax notoginseng enhance phosphate and arsenate acquisition

Genes Primers(5′-3′) Usage
PnPht1;1 F: ATGTCTGGGAATAATCTGCAGG to amplify cDNA ORF
R: CTAAACTTGTGCCTCATTTGCA
PnPht1;2 F: ATGGCTCGAGAGCAACTAGAAG
R: TTATACCGGCACAGTCCTGTTAG
qPnPht1;1 F:GAACGGGAATTTTGGTTGCTG to amplify segments for qPCR
R:AAGTCGCCTTGTGGCTGAGTG
qPnPht1;2 F:GCGCGTTTATAGCGGCTGTTT
R:ACTTTTGCCTCTTGGGGGTCA
26S-2(reference gene) F:CAGTATTTAGCCTTGGACGGAATT
R:CGGGTTGTTTGGGAATGC
SPnPht1;1(BamH I/Kpn I) F: CGCGGATCCATGTCTGGGAATAATCTGCAGG to amplify genes for recombinant plasmid construction in S. cerevisiae
R: CGGGGTACCCTAAACTTGTGCCTCATTTGCA
SPnPht1;2(Xba I/ Xma I) F: TGCTCTAGAATGGCTCGAGAGCAACTAGAAG
R:TCCCCCCGGGTTATACCGGCACAGTCCTGTTAG
NbPnPht1;1(BamH I/Sal I) pENTR F:GAGAACACGGGGGACTGGTACCCGGGGATCCATGTCTGGGAATAATCTGCAGG to amplify genes for recombinant plasmid construction in N. benthamiana
R:ACAGCTCCTCGCCCTTGCTCACCATGTCGACAACTTGTGCCTCATTTGCATCCT
NbPnPht1;2(BamH I/Sal I) pENTR F:GAGAACACGGGGGACTGGTACCCGGGGATCCATGGCTCGAGAGCAACTA
R:ACAGCTCCTCGCCCTTGCTCACCATGTCGAC ACGAATGGCCCTTTTATCC
NbUPF0057(BamH I/Sal I) pENTR F:GAGAACACGGGGGACTGGTACCCGGGGATCCATGGTCTCAAGATGTGCA
R:ACAGCTCCTCGCCCTTGCTCACCATGTCGACAGCAAGAGTGTCATAACG