Table 1 List of primers, amplicon sizes, number of individuals covered by TILLING, number of mutants obtained, and the knock-out mutants obtained for the three homoeoalleles of SSIIa. Entries in bold indicate knock-out mutants selected for developing full null mutants, and for starch composition analyses
Primer name | NCBI Accession of the gene (Shimbata et al. 2005) | Genome | 5′-3′ Sequence | Product Size | Number of M2 Individuals covered | Total number of Mutants obtained | Knock-out Mutant Identity | Nucleotide change | Position of truncation in the knock-out mutants |
|---|---|---|---|---|---|---|---|---|---|
SSIIa-AF | AB201445 | A | TTCCTCTATAATGATCACATGC | 1050 | 1032 | 46 | Box-10-H8 | G > A | W544* |
SSIIa-BF | AB201446 | B | GAATTAGTACATGCTTTGGTCGC | 1042 | 984 | 48 | Box-2-F4 Box-13-C5 | C > T G > A | Q601* W762* |
SSIIa-DF | AB201447 | D | TATACAACACTGACATGCCGAA | 1052 | 1260 | 52 | Box-2-G5 Box-7-E5 | G > A G > A | W544* W555* |
SSIIa-R | – | Common | TCACCACTGGTACTTGGCCTTG | – | – | – | – | – | – |